Hnrnpab (NM_010448) Mouse Untagged Clone

CAT#: MC208675

Hnrnpab (untagged) - Mouse heterogeneous nuclear ribonucleoprotein A/B (Hnrnpab), transcript variant 2, (10ug)



  "NM_010448" in other vectors (6)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 3010025C11Rik; CBF-A; Cgbfa; Hnrpab
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208675 representing NM_010448
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGACGCGGCTGAGGAGCAGCCCATGGAGACGACGGGCGCCACCGAGAACGGACACGAGGCCGCCC
CCGAAGGCGAGGCCCCGGTCGAGCCCAGCGCGGCTGCCGCGGCCCCCGCGGCCTCGGCCGGGTCTGGGGG
CGGGACCACGACCGCACCGAGCGGGAACCAGAACGGCGCGGAGGGCGACCAGATCAACGCCAGCAAGAAC
GAGGAGGACGCGGGAAAAATGTTCGTTGGTGGTCTGAGCTGGGATACCAGCAAAAAAGACTTAAAGGATT
ATTTTACTAAGTTTGGAGAGGTTGTTGACTGTACAATAAAAATGGATCCCAACACTGGACGATCAAGAGG
GTTTGGGTTTATTCTCTTCAAAGATTCTTCTAGTGTGGAAAAGGTCTTAGATCAGAAGGAGCACAGGCTG
GATGGTCGTGTCATTGACCCTAAAAAGGCTATGGCTATGAAGAAGGACCCTGTGAAGAAAATCTTTGTGG
GAGGTCTAAACCCTGAAGCCACAGAGGAAAAGATCAGAGAATACTTCGGCCAGTTTGGGGAGATTGAGGC
CATTGAGCTTCCAATAGATCCCAAGTTGAACAAAAGACGGGGTTTTGTTTTTATTACATTTAAAGAGGAA
GATCCTGTGAAGAAAGTTCTGGAGAAGAAATTTCATACTGTCAGTGGAAGCAAGTGTGAAATCAAGGTTG
CCCAGCCCAAAGAGGTGTATCAGCAACAGCAGTATGGCTCTGGGGGCAGAGGAAATCGCAATCGAGGGAA
CCGAGGCAGTGGTGGAGGTCAGGGTAGTACAAATTACGGAAAGAGCCAGCGACGTGGTGGTCATCAGAAT
AACTACAAGCCATACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010448
Insert Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010448.3, NP_034578.1
RefSeq Size 2404 bp
RefSeq ORF 858 bp
Locus ID 15384
UniProt ID Q99020
Gene Summary This gene encodes a protein with consensus RNA binding domains present in a number of other RNA binding proteins and a glycine-rich C-terminus. This gene overlaps in a tail-to-tail orientation the gene encoding alanine-glyoxylate aminotransferase 2-like 2. Some of the exons of this gene are interspersed with exons of alanine-glyoxylate aminotransferase 2-like 2. Two alternatively spliced transcript variants that encode distinct proteins have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame segment in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...