Gnas (NM_001077510) Mouse Untagged Clone
CAT#: MC208566
Gnas (untagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 8, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 5530400H20Rik; A930027G11Rik; C130027O20Rik; G; Ga; Galphas; Gn; Gnas1; Gnasxl; GPSA; Gs-; Gs-alpha; Gsa; GSP; N; Nes; Nesp; Nesp55; Nespl; Oed; Oed-Sml; Oedsml; P; P1; P2; P3; PHP1A; PHP1B; POH; SCG; SCG6; XL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208566 representing NM_001077510
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCTGCCTCGGCAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAGGCGCAGCGCGAGGCCAACA AAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTACCGGGCCACGCACCGCCTGCTGCTGCTGGG TGCTGGAGAGTCTGGCAAAAGCACCATTGTGAAGCAGATGAGGATCCTGCATGTTAATGGGTTTAACGGA GATAGTGAGAAGGCCACTAAAGTGCAGGACATCAAAAACAACCTGAAGGAGGCCATTGAAACCATTGTGG CCGCCATGAGCAACCTGGTGCCCCCTGTGGAGCTGGCCAACCCTGAGAACCAGTTCAGAGTGGACTACAT TCTGAGCGTGATGAACGTGCCGAACTTTGACTTCCCACCTGAATTCTATGAGCATGCCAAGGCTCTGTGG GAGGATGAGGGAGTGCGTGCCTGCTACGAGCGCTCCAATGAGTACCAGCTGATTGACTGTGCCCAGTACT TCCTGGACAAGATTGATGTGATCAAGCAGGCCGACTACGTGCCAAGTGACCAGGACCTGCTTCGCTGCCG TGTCCTGACCTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTCGATGTG GGCGGCCAGCGCGATGAGCGCCGCAAGTGGATCCAGTGCTTCAATGATGTGACTGCCATCATCTTCGTGG TGGCCAGCAGCAGCTACAACATGGTCATTCGGGAGGACAACCAGACTAACCGCCTGCAGGAGGCTCTGAA CCTCTTCAAGAGCATCTGGAACAACAGATGGCTGCGCACCATCTCTGTGATTCTCTTCCTCAACAAGCAA GACCTGCTTGCTGAGAAAGTCCTCGCTGGCAAATCGAAGATTGAGGACTACTTTCCAGAGTTCGCTCGCT ACACCACTCCTGAGGATGCGACTCCCGAGCCGGGAGAGGACCCACGCGTGACCCGGGCCAAGTACTTCAT TCGGGATGAGTTTCTGAGAATCAGCACTGCTAGTGGAGATGGGCGCCACTACTGCTACCCTCACTTTACC TGCGCCGTGGACACTGAGAACATCCGCCGTGTCTTCAACGACTGCCGTGACATCATCCAGCGCATGCATC TCCGCCAATACGAGCTGCTCTAA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001077510 |
Insert Size | 1143 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001077510.4, NP_001070978.1 |
RefSeq Size | 1720 bp |
RefSeq ORF | 1143 bp |
Locus ID | 14683 |
UniProt ID | P63094 |
Gene Summary | This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015] Transcript Variant: This variant (8) is biallelically expressed. It lacks an internal exon and uses an alternate splice site, compared to variant 7. It encodes the isoform GNASS, also known as alpha-S1, which lacks an internal segment and has two amino acids different, compared to isoform GNASL. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225858 | Gnas (tGFP-tagged) - Mouse GNAS (guanine nucleotide binding protein alpha stimulating) complex locus (Gnas) transcript variant 8, (10ug) |
CNY 4,180.00 |
|
MR225858 | Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 8 |
CNY 3,800.00 |
|
MR225858L3 | Lenti ORF clone of Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 8 |
CNY 5,700.00 |
|
MR225858L4 | Lenti ORF clone of Gnas (mGFP-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 8 |
CNY 5,700.00 |