United States
Germany
Japan
United Kingdom
China
Elf3 (NM_001163131) Mouse Untagged Clone
CAT＃: MC208431
Elf3 (untagged) - Mouse E74-like factor 3 (Elf3), transcript variant 1, (10ug)
CNY 3,656.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ESE-1; ESX; jen |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001163131, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCCACCTGTGAGATCAGCAACGTTTTTAGTAACTACTTCAACGCCATGTACAGCTCAGAAGACC CCACCCTGGCTCCTGCTCCTCCGACTACCTTTGGCACTGAAGACTTGGTGTTGACCCTGAACAACCAACA GATGACACTGGAAGGTCCAGGACCTCAGACAAGATCCCAAAGGGACAGGACTGATCCTCTGGCTGTACTC CACCTTGCAGAGAAGGCAAGCTGGACTAGCGAGCGGCCCCAGTTCTGGTCGAAGACCCAGGTTCTGGAGT GGATCAGCTACCAAGTGGAGAAGAACAAGTATGACGCCAGCTCCATCGACTTCTCCCGCTGCGACATGGA CGGAGCCACCCTCTGCAGCTGTGCGCTGGAGGAGCTGCGGCTAGTCTTTGGACCTCTGGGAGACCAGCTC CATGCCCAGCTTCGGGACCTCACCTCCAACTCTTCTGATGAACTCAGCTGGATCATCGAGCTGCTGGAGA AGGATGGCATGTCCTTCCAAGAGAGCCTAGGCGACTCGGGCCCCTTTGATCAGGGAAGTCCTTTTGCCCA GGAACTCCTGGATGATGGCCGCCAGGCCAGTCCCTACTACTGCAGTACCTATGGCCCTGGAGCGCCCTCC CCCGGCAGCTCTGATGTCTCCACTGCAAGGACCGCTACTCCCCAGAGTTCCCATGCTTCTGACTCCGGTG GAAGTGATGTGGACCTGGACCTCACCGAGAGCAAGGTCTTCCCTAGAGATGGCTTTCCTGACTATAAGAA GGGGGAACCCAAGCACGGGAAGAGGAAACGGGGGCGTCCCAGAAAGCTGAGCAAGGAATACTGGGACTGT CTGGAGGGCAAGAAGAGCAAGCACGCCCCCAGAGGTACTCACCTGTGGGAGTTTATCCGAGACATCCTAA TCCACCCCGAGCTCAACGAAGGCCTCATGAAGTGGGAGAACCGGCACGAGGGTGTGTTCAAGTTTCTTCG CTCAGAGGCCGTGGCCCAACTCTGGGGCCAGAAGAAGAAGAACAGCAACATGACCTATGAGAAGCTGAGC CGAGCCATGAGGTATTACTACAAACGGGAGATCCTGGAACGGGTGGATGGCCGACGGCTCGTCTACAAGT TTGGCAAGAACTCTAGTGGCTGGAAGGAAGAAGAGGTTGGAGAGAGTCGGAATTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001163131 |
| Insert Size | 1176 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC145380, AAI45381 |
| RefSeq Size | 1919 bp |
| RefSeq ORF | 1176 bp |
| Locus ID | 13710 |
| UniProt ID | Q3UPW2 |
| Gene Summary | Transcriptional activator that binds and transactivates ETS sequences containing the consensus nucleotide core sequence GGA[AT]. Acts synergistically with POU2F3 to transactivate the SPRR2A promoter and with RUNX1 to transactivate the ANGPT1 promoter (By similarity). Also transactivates collagenase, CCL20, CLND7, FLG, KRT8, NOS2, PTGS2, SPRR2B, TGFBR2 and TGM3 promoters. Represses KRT4 promoter activity (By similarity). Involved in mediating vascular inflammation. May play an important role in epithelial cell differentiation and tumorigenesis. May be a critical downstream effector of the ERBB2 signaling pathway (By similarity). May be associated with mammary gland development and involution. Plays an important role in the regulation of transcription with TATA-less promoters in preimplantation embryos, which is essential in preimplantation development.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223180 | Elf3 (tGFP-tagged) - Mouse E74-like factor 3 (Elf3) transcript variant 1, (10ug) |
CNY 5,624.00 |
|
| MR223180 | Elf3 (Myc-DDK-tagged) - Mouse E74-like factor 3 (Elf3), transcript variant 1 |
CNY 3,900.00 |
|
| MR223180L3 | Lenti ORF clone of Elf3 (Myc-DDK-tagged) - Mouse E74-like factor 3 (Elf3), transcript variant 1 |
CNY 5,800.00 |
|
| MR223180L4 | Lenti ORF clone of Elf3 (mGFP-tagged) - Mouse E74-like factor 3 (Elf3), transcript variant 1 |
CNY 5,800.00 |
