Efna3 (NM_010108) Mouse Untagged Clone
CAT#: MC208423
Efna3 (untagged) - Mouse ephrin A3 (Efna3), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AW494418; EFL-2; Ehk1-L; Epl3; LERK-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_010108, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGGCTCCGCTGCTGCTGCTGCTGCTGCTCGTGCCCGTGCCGCTGCTGCCGCTGCTGGCCCAGG GGCCTGGGGGCGCACTGGGAAACCGGCATGCGGTATACTGGAACAGCTCCAATCAGCACCTGCGGCGAGA GGGCTACACCGTGCAGGTGAACGTGAACGACTATCTGGATATTTACTGTCCGCACTACAACAGCTCAGGG CCTGGCGGCGGGGCGGAGCAGTACGTGCTGTACATGGTGAACCTGAGCGGCTACCGCACCTGCAACGCCA GCCAAGGCTCCAAGCGCTGGGAATGCAACCGGCAGCACGCCTCGCACAGCCCCATCAAGTTCTCCGAGAA GTTCCAGCGTTACAGCGCCTTCTCGCTGGGCTATGAATTCCATGCCGGCCAAGAATACTACTACATCTCC ACGCCCACTCACAACCTGCACTGGAAGTGTCTGAGGATGAAGGTGTTCGTCTGCTGCGCCTCCACATCGC ACTCCGGGGAGAAGCCGGTCCCCACTCTCCCCCAGTTCACCATGGGCCCCAATGTGAAGATCAACGTGTT GGAAGACTTTGAGGGAGAGAATCCCCAGGTGCCCAAGCTTGAGAAGAGCATCAGTGGGACCAGCCCCAAG CGGGAACACCTGCCTCTGGCCGTGGGCATCGCCTTCTTCCTCATGACGCTCTTGGCCTCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_010108 |
Insert Size | 693 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC125003, AAI25004 |
RefSeq Size | 1225 bp |
RefSeq ORF | 693 bp |
Locus ID | 13638 |
UniProt ID | O08545 |
Gene Summary | Cell surface GPI-bound ligand for Eph receptors, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development. Binds promiscuously Eph receptors residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226272 | Efna3 (tGFP-tagged) - Mouse ephrin A3 (Efna3), (10ug) |
CNY 2,850.00 |
|
MR226272 | Efna3 (Myc-DDK-tagged) - Mouse ephrin A3 (Efna3) |
CNY 2,400.00 |
|
MR226272L3 | Lenti ORF clone of Efna3 (Myc-DDK-tagged) - Mouse ephrin A3 (Efna3) |
CNY 4,750.00 |
|
MR226272L4 | Lenti ORF clone of Efna3 (mGFP-tagged) - Mouse ephrin A3 (Efna3) |
CNY 4,750.00 |