Dgcr6 (NM_010047) Mouse Untagged Clone
CAT#: MC208387
Dgcr6 (untagged) - Mouse DiGeorge syndrome critical region gene 6 (Dgcr6), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208387 representing NM_010047
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTAGAGAGCATGGCACCAGCCAGCTCCTTTCAGCAGCGCCTGTCCTACACCACGCTCAGCGACTTGG CCCTGGCGCTGCTCGACGGAACGGTGTTTGAAATCGTGCAGGGTCTTCTGGAGATTCAGCACCTCACTGA GAAGAGCCTCTACAACCAGAGACTGCGGCTGCAGAACGAACACCGAGTGCTCAGACAGACTCTAAGGCAG AAGCACCTGGAAGCCCAGCAGTCCTGCCGGCCCCACAACTTGCCAGTGCTCCAGGCAGCTCAGCAGCGTG AGCTGGAGGCCATGGAACATCGGATCCGGGAGGAGCAGCAGGCTATGGACCGAAAGATTGTCCTGGAGCT GGACCGGAAGGTTGCCGACCAGCAGAGCACACTGGAGAAGGCAGGGGTAGCTGGTTTCTACGTGACCACC AATCCTCAGGAGCTGACGCTGCAGATGAACCTATTGGAACTCATCAGGAAGCTGCAGCAGAGGGGCTGCC AAGTGGGAAAGGCAGCTCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010047 |
Insert Size | 513 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_010047.4, NP_034177.1 |
RefSeq Size | 1552 bp |
RefSeq ORF | 513 bp |
Locus ID | 13353 |
UniProt ID | O35347 |
Gene Summary | This gene encodes a protein that is similar to the gonadal protein in Drosophila (fruit fly). The encoded protein is thought to play a role in migration of neural crest cells during development. Deletions in the human gene are associated with DiGeorge syndrome (or velocardiofacial syndrome) which has many clinical features including cardiac abnormalities, cleft palate, atypical facial features, hypocalcemia, hypoparathyroidism and defective development or congenital absence of the thymus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (3) represents the use of an alternate promoter and has multiple differences compared to variant 1. These differences result in a different 5' UTR and cause translation initiation at an alternate start codon compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223590 | Dgcr6 (tGFP-tagged) - Mouse DiGeorge syndrome critical region gene 6 (Dgcr6), (10ug) |
CNY 2,090.00 |
|
MR223590 | Dgcr6 (Myc-DDK-tagged) - Mouse DiGeorge syndrome critical region gene 6 (Dgcr6) |
CNY 1,900.00 |
|
MR223590L3 | Lenti ORF clone of Dgcr6 (Myc-DDK-tagged) - Mouse DiGeorge syndrome critical region gene 6 (Dgcr6) |
CNY 3,800.00 |
|
MR223590L4 | Lenti ORF clone of Dgcr6 (mGFP-tagged) - Mouse DiGeorge syndrome critical region gene 6 (Dgcr6) |
CNY 3,800.00 |