Dcx (NM_010025) Mouse Untagged Clone

CAT#: MC208372

Dcx (untagged) - Mouse doublecortin (Dcx), transcript variant 4, (10ug)



  "NM_010025" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Anti-Doublecortin / DCX (aa232-242) Antibody
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Dbct
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208372 representing NM_010025
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACTTGATTTTGGACATTTTGACGAACGAGACAAAGCATCTAGAAATATGAGAGGGTCACGGATGA
ATGGACTTCCAAGTCCCACTCATAGTGCCCACTGTAGCTTCTACAGAACCAGAACCTTGCAGGCATTAAG
TAATGAGAAGAAGGCCAAGAAGGTACGTTTCTACCGCAATGGGGACCGTTACTTCAAGGGGATTGTGTAC
GCTGTTTCTTCTGACCGTTTTCGTAGTTTTGATGCGTTGCTGGCTGACCTGACCCGATCCTTGTCTGACA
ACATTAACCTGCCTCAGGGAGTGCGCTACATTTATACCATTGACGGATCCAGGAAGATTGGAAGCATGGA
TGAACTGGAAGAAGGGGAAAGCTATGTCTGCTCCTCAGACAACTTCTTTAAAAAGGTTGAGTACACCAAG
AATGTCAACCCCAACTGGTCTGTCAACGTAAAGACATCTGCCAACATGAAAGCCCCCCAGTCCTTGGCTA
GCAGCAACAGTGCTCAAGCCAGAGAGAACAAGGACTTTGTGCGCCCCAAACTTGTGACCATCATTCGCAG
CGGGGTGAAGCCACGGAAGGCTGTGCGCGTGCTTCTCAACAAGAAAACAGCCCACTCTTTCGAGCAGGTC
CTGACTGACATCACAGAAGCGATCAAACTGGAAACCGGAGTTGTCAAAAAACTCTACACCCTTGATGGAA
AGCAGGTCACCTGTCTCCATGATTTCTTTGGTGATGATGATGTGTTCATTGCTTGTGGTCCTGAAAAATT
CCGCTATGCTCAAGATGATTTCTCCTTGGATGAGAATGAATGCAGAGTCATGAAAGGGAATCCATCTGCC
GCAGCTGGCCCAAAGGCTTCCCCAACACCTCAAAAGACATCTGCTAAAAGCCCAGGCCCAATGCGCCGCA
GCAAGTCTCCAGCTGACTCAGCAAATGGAACTTCCAGCAGTCAGCTCTCAACACCTAAGTCAAAGCAGTC
TCCTATCTCTACACCCACAAGCCCTGGAAGTCTGCGGAAGCACAAGGACCTGTACCTGCCGCTGTCATTG
GATGACTCTGATTCACTTGGCGATTCCATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010025
Insert Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010025.2, NP_034155.2
RefSeq Size 8982 bp
RefSeq ORF 1083 bp
Locus ID 13193
UniProt ID O88809
Gene Summary This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. Studies in knockout mice lacking this gene and the LIS1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. Multiple transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (4) differs in the 5' UTR, and has two alternate in-frame splice sites in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform c), compared to isoform a. Sequence Note: This RefSeq record was created using sequences from two different strains, C57BL/6J and C57BL/6, because no single transcript from the same strain was available for the full length of the gene.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...