Dclk1 (NM_001195540) Mouse Untagged Clone
CAT#: MC208367
Dclk1 (untagged) - Mouse doublecortin-like kinase 1 (Dclk1), transcript variant 7, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700113D08Rik; 2810480F11Rik; AI836758; Clic; Click-I; CPG1; Cpg16; Dc; Dcamk; Dcamkl1; Dcl; Dclk; mKIAA0369 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208367 representing NM_001195540
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTAGAGCTCATAGAAGTTAATGGAACCCCTGGTAGTCAGCTCTCTACTCCACGCTCGGGCAAGTCAC CAAGTCCATCACCCACCAGCCCAGGAAGCCTGCGGAAGCAGAGGGACCTGTACCGCCCCCTCTCGTCGGA TGATTTGGACTCAGTAGGAGACTCAGTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195540 |
Insert Size | 171 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001195540.1, NP_001182469.1 |
RefSeq Size | 5175 bp |
RefSeq ORF | 171 bp |
Locus ID | 13175 |
Gene Summary | This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010] Transcript Variant: This variant (7) is produced from the 3' promoter. It shares only one exon with variant 5, and encodes a 56 aa isoform [7, also known as ania-4, or CARP (CaMK-related peptide)], which mainly consists of the serine/proline-rich domain. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226416 | Dclk1 (tGFP-tagged) - Mouse doublecortin-like kinase 1 (Dclk1) transcript variant 7, (10ug) |
CNY 2,090.00 |
|
MR226416 | Dclk1 (Myc-DDK-tagged) - Mouse doublecortin-like kinase 1 (Dclk1), transcript variant 7 |
CNY 1,900.00 |
|
MR226416L3 | Lenti ORF clone of Dclk1 (Myc-DDK-tagged) - Mouse doublecortin-like kinase 1 (Dclk1), transcript variant 7 |
CNY 3,800.00 |
|
MR226416L4 | Lenti ORF clone of Dclk1 (mGFP-tagged) - Mouse doublecortin-like kinase 1 (Dclk1), transcript variant 7 |
CNY 3,800.00 |