Csf1 (NM_001113529) Mouse Untagged Clone

CAT#: MC208341

Csf1 (untagged) - Mouse colony stimulating factor 1 (macrophage) (Csf1), transcript variant 2, (10ug)



  "NM_001113529" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C87615; Csfm; MCSF; op
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NM_001113529.1
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCGCGCGGGGCGCCGCGGGGCGCTGCCCTTCTTCGACATGGCTGGGCTCCCGGCTGCTGCTGGTCT
GTCTCCTCATGAGCAGGAGTATTGCCAAGGAGGTGTCAGAACACTGTAGCCACATGATTGGGAATGGACA
CCTGAAGGTCCTGCAGCAGTTGATCGACAGTCAAATGGAGACTTCATGCCAGATTGCCTTTGAATTTGTA
GACCAGGAACAGCTGGATGATCCTGTTTGCTACCTAAAGAAGGCCTTTTTTCTGGTACAAGACATAATAG
ATGAGACCATGCGCTTTAAAGACAACACCCCCAATGCTAACGCCACCGAGAGGCTCCAGGAACTCTCCAA
TAACCTGAACAGCTGCTTCACCAAGGACTATGAGGAGCAGAACAAGGCCTGTGTCCGAACTTTCCATGAG
ACTCCTCTCCAGCTGCTGGAGAAGATCAAGAACTTCTTTAATGAAACAAAGAATCTCCTTGAAAAGGACT
GGAACATTTTTACCAAGAACTGCAACAACAGCTTTGCTAAGTGCTCTAGCCGAGGCCATGTGGAGCAGCA
TGAGGGATCCTCTGACCCCCAGATCCCTGAGTCTGTCTTCCACCTGCTGGTGCCGGGCATCATCCTAGTC
TTGCTGACTGTTGGGGGCCTCCTGTTCTACAAGTGGAAGTGGAGGAGCCATCGAGACCCTCAGACATTGG
ATTCTTCTGTGGGGCGACCAGAGGACAGCTCCCTGACCCAGGATGAGGACAGACAGGTGGAACTGCCAGT
ATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001113529
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001113529.1, NP_001107001.1
RefSeq Size 3307 bp
RefSeq ORF 774 bp
Locus ID 12977
UniProt ID P07141
Gene Summary Cytokine that plays an essential role in the regulation of survival, proliferation and differentiation of hematopoietic precursor cells, especially mononuclear phagocytes, such as macrophages and monocytes. Promotes the release of proinflammatory chemokines, and thereby plays an important role in innate immunity and in inflammatory processes. Plays an important role in the regulation of osteoclast proliferation and differentiation, the regulation of bone resorption, and is required for normal bone development. Required for normal male and female fertility. Promotes reorganization of the actin cytoskeleton, regulates formation of membrane ruffles, cell adhesion and cell migration. Plays a role in lipoprotein clearance.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...