Crh (NM_205769) Mouse Untagged Clone
CAT#: MC208331
Crh (untagged) - Mouse corticotropin releasing hormone (Crh), (10ug)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CR; CRF; Gm1347 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208331 representing NM_205769
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGGCTGCGGCTGCTGGTGTCCGCGGGCATGCTGCTGGTGGCTCTGTCGTCCTGCCTGCCTTGCAGGG CCCTGCTCAGCAGGGGATCCGTCCCCCGAGCGCCGCGGGCCCCGCAGCCCTTGAATTTCTTGCAGCCGGA GCAGCCCCAGCAACCTCAGCCGGTTCTGATCCGCATGGGTGAAGAATACTTCCTCCGCCTGGGGAATCTC AACAGAAGTCCCGCTGCTCGGCTGTCCCCCAACTCCACGCCCCTCACCGCGGGTCGCGGCAGCCGCCCCT CGCACGACCAGGCTGCGGCTAACTTTTTCCGCGTGTTGCTGCAGCAGCTGCAGATGCCTCAGCGCTCGCT CGACAGCCGCGCGGAGCCGGCCGAACGCGGCGCCGAGGATGCCCTCGGTGGCCACCAGGGGGCGCTGGAG AGGGAGAGGCGGTCGGAGGAGCCGCCCATCTCTCTGGATCTCACCTTCCACCTTCTGCGGGAAGTCTTGG AAATGGCCCGGGCAGAGCAGTTAGCTCAGCAAGCTCACAGCAACAGGAAACTGATGGAGATTATCGGGAA ATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_205769 |
Insert Size | 564 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_205769.3, NP_991338.1 |
RefSeq Size | 1320 bp |
RefSeq ORF | 564 bp |
Locus ID | 12918 |
UniProt ID | Q8CIT0 |
Gene Summary | This gene encodes a member of the corticotropin-releasing factor family and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a neuropeptide hormone that binds to the corticotropin releasing hormone receptors (CRHR1 and CRHR2) to stimulate the release of adrenocorticotropic hormone from the pituitary gland in response to stress. The encoded protein may also regulate angiogenesis and inflammation. Homozygous knockout mice for this gene exhibit reduced corticosterone levels while the offspring of these mice die perinatally. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226140 | Crh (tGFP-tagged) - Mouse corticotropin releasing hormone (Crh), (10ug) |
CNY 4,370.00 |
|
MR226140 | Crh (Myc-DDK-tagged) - Mouse corticotropin releasing hormone (Crh) |
CNY 3,600.00 |
|
MR226140L3 | Lenti ORF clone of Crh (Myc-DDK-tagged) - Mouse corticotropin releasing hormone (Crh) |
CNY 5,890.00 |
|
MR226140L4 | Lenti ORF clone of Crh (mGFP-tagged) - Mouse corticotropin releasing hormone (Crh) |
CNY 5,890.00 |