Creb1 (NM_001037726) Mouse Untagged Clone

CAT#: MC208319

Creb1 (untagged) - Mouse cAMP responsive element binding protein 1 (Creb1), transcript variant C, (10ug)



  "NM_001037726" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CREB1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310001E10Rik; 3526402H21Rik; AV083133; Creb; Creb-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208319 representing NM_001037726
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGCAGCTCATGCAACATCATCTGCTCCCACTGTAACCTTAGTGCAGCTGCCCAATGGGCAGACAG
TCCAGGTCCATGGCGTTATCCAGGCGGCCCAGCCATCAGTTATCCAGTCTCCACAAGTCCAAACAGTTCA
GATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCTGTGGATAGTGTAACTGATTCCCAAAAACGA
AGGGAAATCCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGGG
TGCCAAGGATTGAAGAAGAAAAGTCAGAAGAGGAGACTTCAGCCCCTGCCATCACCACTGTAACAGTGCC
AACCCCCATTTACCAAACTAGCAGTGGGCAGTACATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCT
AACAATGGTACGGATGGGGTACAGGGCCTGCAGACATTAACCATGACCAATGCAGCTGCCACTCAGCCGG
GTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATTCTAGTGCCCAGCAACCAAGTTGT
TGTTCAAGCTGCCTCAGGCGATGTACAAACATACCAGATCCGCACAGCACCCACGAGCACCATTGCCCCT
GGAGTTGTTATGGCGTCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGGAAGAGAGAGG
TCCGTCTAATGAAGAACAGGGAGGCAGCAAGAGAATGTCGTAGAAAGAAGAAAGAATATGTGAAATGTTT
AGAGAACAGAGTGGCAGTGCTTGAAAACCAAAACAAAACATTGATTGAGGAGCTAAAAGCACTTAAGGAC
CTTTACTGCCACAAATCAGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001037726
Insert Size 864 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001037726.1, NP_001032815.1
RefSeq Size 8267 bp
RefSeq ORF 864 bp
Locus ID 12912
Gene Summary Phosphorylation-dependent transcription factor that stimulates transcription upon binding to the DNA cAMP response element (CRE), a sequence present in many viral and cellular promoters. Transcription activation is enhanced by the TORC coactivators which act independently of Ser-133 phosphorylation. Involved in different cellular processes including the synchronization of circadian rhythmicity and the differentiation of adipose cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (C) lacks an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant A. The encoded protein (isoform C) has a shorter N-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...