Cd72 (NM_007654) Mouse Untagged Clone
CAT#: MC208255
Cd72 (untagged) - Mouse CD72 antigen (Cd72), transcript variant 2, (10ug)
CNY 3,656.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CD72c; Ly-19; Ly-32; Ly-m19; Lyb-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208255 representing NM_007654
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_007654 |
Insert Size | 1065 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007654.2, NP_031680.2 |
RefSeq Size | 1482 bp |
RefSeq ORF | 1065 bp |
Locus ID | 12517 |
UniProt ID | P21855 |
Gene Summary | Plays a role in B-cell proliferation and differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG219399 | Cd72 (tGFP-tagged) - Mouse CD72 antigen (Cd72) transcript variant 2, (10ug) |
CNY 3,710.00 |
|
MR219399 | Cd72 (Myc-DDK-tagged) - Mouse CD72 antigen (Cd72), transcript variant 2 |
CNY 3,656.00 |
|
MR219399L3 | Lenti ORF clone of Cd72 (Myc-DDK-tagged) - Mouse CD72 antigen (Cd72), transcript variant 2 |
CNY 5,230.00 |
|
MR219399L4 | Lenti ORF clone of Cd72 (mGFP-tagged) - Mouse CD72 antigen (Cd72), transcript variant 2 |
CNY 5,230.00 |