Cck (NM_031161) Mouse Untagged Clone
CAT#: MC208226
Cck (untagged) - Mouse cholecystokinin (Cck), (10ug)
CNY 1,800.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208226 representing NM_031161
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAGCGGCGTATGTCTGTGCGTGGTGATGGCAGTCCTAGCTGCTGGCGCCCTGGCGCAGCCGGTAG TCCCTGCAGAAGCTACGGACCCCGTGGAGCAGCGGGCGCAAGAGGCGCCCCGAAGGCAGCTGCGGGCTGT GCTCCGGACGGACGGCGAGCCCCGAGCGCGCCTGGGCGCACTGCTAGCGCGATACATCCAGCAGGTCCGC AAAGCTCCTTCTGGCCGCATGTCCGTTCTTAAGAACCTGCAGAGCCTGGACCCCAGCCATAGAATAAGTG ACCGGGACTACATGGGCTGGATGGATTTTGGCCGGCGCAGTGCCGAGGACTACGAATACCCATCGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_031161 |
Insert Size | 348 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_031161.3, NP_112438.1 |
RefSeq Size | 707 bp |
RefSeq ORF | 348 bp |
Locus ID | 12424 |
UniProt ID | P09240 |
Gene Summary | This gene encodes a member of the gastrin/cholecystokinin family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the peptide hormones cholecystokinin-8, -12, -33, and others. The encoded peptides have been shown to regulate gastric acid secretion and food intake. A sulfated form of cholecystokinin-8 may modulate neuronal activity in the brain. Homozygous knockout mice for this gene exhibit impaired insulin secretion, enhanced insulin sensitivity, and resistance to obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) represents the predominant transcript and encodes isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227030 | Cck (tGFP-tagged) - Mouse cholecystokinin (Cck), (10ug) |
CNY 2,090.00 |
|
MR227030 | Cck (Myc-DDK-tagged) - Mouse cholecystokinin (Cck) |
CNY 1,900.00 |
|
MR227030L3 | Lenti ORF clone of Cck (Myc-DDK-tagged) - Mouse cholecystokinin (Cck) |
CNY 3,800.00 |
|
MR227030L4 | Lenti ORF clone of Cck (mGFP-tagged) - Mouse cholecystokinin (Cck) |
CNY 3,800.00 |