Bmi1 (NM_007552) Mouse Untagged Clone

CAT#: MC208192

Bmi1 (untagged) - Mouse Bmi1 polycomb ring finger oncogene (Bmi1), (10ug)



  "NM_007552" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
Bmi1 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW546694; Bmi-1; Pcgf4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208192 representing NM_007552
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATCGAACAACCAGAATCAAGATCACTGAGCTAAATCCCCACTTAATGTGTGTCCTGTGTGGAGGGT
ACTTCATTGATGCCACTACCATAATAGAATGTCTACATTCCTTCTGTAAAACATGTATTGTACGTTACTT
GGAGACCAGCAAGTATTGTCCTATTTGTGATGTCCAGGTTCACAAAACCAGACCACTCCTGAACATAAGG
TCAGATAAAACTCTTCAAGATATTGTATACAAATTAGTCCCAGGGCTTTTCAAAAATGAGATGAAGAGAA
GAAGAGATTTTTATGCAGCTCACCCGTCAGCTGATGCTGCCAATGGCTCCAATGAAGACCGAGGAGAAGT
TGCAGATGAGGAGAAGAGGATTATAACTGATGATGAGATAATAAGCTTGTCTATTGAGTTCTTTGATCAG
AGCAGATTGGATCGGAAAGTAAATAAAGAGAAGCCTAAGGAAGAGGTGAATGATAAAAGGTACTTACGAT
GCCCAGCAGCAATGACTGTGATGCACTTGAGAAAGTTTCTCAGGAGTAAAATGGACATACCCAATACTTT
CCAGATTGACGTCATGTATGAAGAGGAACCTTTAAAGGATTACTACACGCTAATGGACATTGCCTACATT
TATACCTGGAGAAGAAATGGCCCACTACCTTTGAAATACAGAGTTCGGCCAACTTGCAAAAGAATGAAGA
TGAGTCACCAGAGGGATGGACTGACGAATGCTGGAGAGCTGGAAAGTGACTCTGGGAGTGACAAGGCCAA
CAGCCCAGCCGGAGGTGTTCCCTCCACCTCTTCCTGTTTGCCCAGTCCCAGCACTCCAGTGCAGTCTCCT
CACCCACAGTTCCCTCACATTTCCAGTACCATGAATGGAACCAGCAACAGCCCCAGTGCTAACCACCAAT
CTTCCTTTGCCAGTAGACCTCGAAAATCATCACTAAATGGGTCATCAGCAACTTCATCTGGTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007552
Insert Size 975 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_007552.4, NP_031578.2
RefSeq Size 3594 bp
RefSeq ORF 975 bp
Locus ID 12151
UniProt ID P25916
Gene Summary Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. The complex composed of RNF2, UB2D3 and BMI1 binds nucleosomes, and has activity only with nucleosomal histone H2A. In the PRC1-like complex, regulates the E3 ubiquitin-protein ligase activity of RNF2/RING2 (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...