United States
Germany
Japan
United Kingdom
China
Arc (NM_018790) Mouse Untagged Clone
CAT＃: MC208145
Arc (untagged) - Mouse activity regulated cytoskeletal-associated protein (Arc), (10ug)
CNY 5,488.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Arc3.1; arg3.1; C86064; mArc |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208145 representing NM_018790
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTGGACCATATGACCACCGGCGGCCTCCACGCCTACCCTGCCCCGCGGGGTGGGCCGGCCGCCA AACCCAATGTGATCCTGCAGATTGGTAAGTGCCGAGCTGAGATGCTGGAACACGTACGGAGGACCCACCG GCATCTGTTGACCGAAGTGTCCAAGCAGGTGGAGCGAGAGCTGAAAGGGTTGCACAGGTCGGTGGGCAAG CTGGAGAACAACTTGGACGGCTACGTGCCCACCGGCGACTCACAGCGCTGGAAGAAGTCCATCAAGGCCT GTCTTTGCCGCTGCCAGGAGACCATCGCCAACCTGGAGCGCTGGGTCAAGCGTGAGATGCACGTGTGGAG GGAGGTCTTCTACCGTCTGGAGAGGTGGGCTGACCGCCTGGAGTCCATGGGCGGCAAATACCCAGTGGGC AGCGAGCCGGCCCGCCACACTGTCTCTGTAGGTGTGGGGGGTCCAGAGCCCTACTGCCAGGAAGCTGATG GCTATGACTATACCGTTAGCCCCTATGCCATCACCCCGCCACCTGCCGCAGGAGAACTGCCTGAACAGGA GTCAGTTGAGGCTCAGCAATATCAGTCTTGGGGGCCAGGTGAGGATGGGCAACCGAGCCCTGGTGTGGAT ACACAGATCTTCGAGGACCCACGGGAGTTCCTGAGCCACCTGGAAGAGTACCTGCGGCAGGTGGGTGGCT CTGAAGAATATTGGCTGTCCCAGATCCAGAACCACATGAATGGGCCAGCCAAGAAGTGGTGGGAGTTCAA GCAGGGCTCGGTGAAGAACTGGGTGGAGTTCAAGAAGGAGTTTCTGCAATACAGTGAGGGTACACTCTCC CGTGAAGCCATTCAGCGGGAGCTGGAGCTGCCGCAGAAGCAGGGTGAACCACTCGACCAGTTCCTCTGGC GCAAGCGGGACCTGTACCAGACACTGTATGTGGACGCTGAGGAGGAGGAGATCATTCAGTATGTGGTGGG CACCCTGCAGCCCAAACTCAAGCGCTTTCTGCGCCACCCACTCCCCAAGACCCTGGAGCAGCTTATCCAG AGGGGTATGGAAGTGCAGGACGGCCTGGAGCAGGCAGCTGAGCCTTCTGGCACCCCACTGCCCACAGAGG ATGAGACGGAGGCACTCACACCTGCTCTTACCAGCGAGTCAGTAGCCAGTGACAGGACCCAGCCTGAATA G ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_018790 |
| Insert Size | 1191 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC023127, AAH23127 |
| RefSeq Size | 3059 bp |
| RefSeq ORF | 1191 bp |
| Locus ID | 11838 |
| UniProt ID | Q9WV31 |
| Gene Summary | Master regulator of synaptic plasticity that self-assembles into virion-like capsids that encapsulate RNAs and mediate intercellular RNA transfer in the nervous system (By similarity). ARC protein is released from neurons in extracellular vesicles that mediate the transfer of ARC mRNA into new target cells, where ARC mRNA can undergo activity-dependent translation (By similarity). ARC capsids are endocytosed and are able to transfer ARC mRNA into the cytoplasm of neurons (By similarity). Acts as a key regulator of synaptic plasticity: required for protein synthesis-dependent forms of long-term potentiation (LTP) and depression (LTD) and for the formation of long-term memory (PubMed:29264923, PubMed:24094104). Regulates synaptic plasticity by promoting endocytosis of AMPA receptors (AMPARs) in response to synaptic activity: this endocytic pathway maintains levels of surface AMPARs in response to chronic changes in neuronal activity through synaptic scaling, thereby contributing to neuronal homeostasis (PubMed:17088213, PubMed:20211139, PubMed:20228806). Acts as a postsynaptic mediator of activity-dependent synapse elimination in the developing cerebellum by mediating elimination of surplus climbing fiber synapses (PubMed:23791196). Accumulates at weaker synapses, probably to prevent their undesired enhancement (By similarity). This suggests that ARC-containing virion-like capsids may be required to eliminate synaptic material (By similarity). Required to transduce experience into long-lasting changes in visual cortex plasticity and for long-term memory (PubMed:17088210, PubMed:20228806). Involved in postsynaptic trafficking and processing of amyloid-beta A4 (APP) via interaction with PSEN1 (PubMed:22036569). In addition to its role in synapses, also involved in the regulation of the immune system: specifically expressed in skin-migratory dendritic cells and regulates fast dendritic cell migration, thereby regulating T-cell activation (PubMed:28783680).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. CCDS Note: This CCDS ID represents the protein described in PMIDs: 10727859 and 22036569. This protein is encoded by two splice variants which are supported by AK157822.1 and AF162777.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 22036569. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG206218 | Arc (tGFP-tagged) - Mouse activity regulated cytoskeletal-associated protein (Arc) |
CNY 4,370.00 |
|
| MR206218 | Arc (Myc-DDK-tagged) - Mouse activity regulated cytoskeletal-associated protein (Arc) |
CNY 5,488.00 |
|
| MR206218L1 | Lenti ORF clone of Arc (Myc-DDK-tagged) - Mouse activity regulated cytoskeletal-associated protein (Arc) |
CNY 5,890.00 |
|
| MR206218L2 | Lenti ORF clone of Arc (mGFP-tagged) - Mouse activity regulated cytoskeletal-associated protein (Arc) |
CNY 7,888.00 |
|
| MR206218L3 | Lenti ORF clone of Arc (Myc-DDK-tagged) - Mouse activity regulated cytoskeletal-associated protein (Arc) |
CNY 5,890.00 |
|
| MR206218L4 | Lenti ORF clone of Arc (mGFP-tagged) - Mouse activity regulated cytoskeletal-associated protein (Arc) |
CNY 7,888.00 |
