United States
Germany
Japan
United Kingdom
China
Apoa2 (NM_013474) Mouse Untagged Clone
CAT＃: MC208135
Apoa2 (untagged) - Mouse apolipoprotein A-II (Apoa2), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A; Al; Alp-2; Ap; Apo-AII; Apoa-2; ApoA-II; ApoAII; Hdl-; Hdl-1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208135 representing NM_013474
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGAC AGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGA TTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAG CAGCTGACACCCCTTGTCAGGTCAGCAGGAACTAGTCTGGTGAACTTCTTCAGCAGTTTAATGAACCTTG AGGAGAAACCGGCTCCTGCGGCTAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_013474 |
| Insert Size | 309 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013474.2, NP_038502.2 |
| RefSeq Size | 521 bp |
| RefSeq ORF | 309 bp |
| Locus ID | 11807 |
| UniProt ID | P09813 |
| Gene Summary | This gene encodes a component of high density lipoproteins (HDL). Mice lacking the encoded protein have low HDL-cholesterol levels, smaller HDL particles, increased clearance of triglyceride-rich lipoproteins and insulin hypersensitivity. Transgenic mice overexpressing the encoded protein have elevated levels of HDL-cholesterol and show increased susceptibility to atherosclerosis. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (1) encodes the functional protein. Variants 1, 2, 3 and 4 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG220526 | Apoa2 (tGFP-tagged) - Mouse apolipoprotein A-II (Apoa2), (10ug) |
CNY 2,850.00 |
|
| MR220526 | Apoa2 (Myc-DDK-tagged) - Mouse apolipoprotein A-II (Apoa2) |
CNY 1,200.00 |
|
| MR220526L3 | Lenti ORF clone of Apoa2 (Myc-DDK-tagged) - Mouse apolipoprotein A-II (Apoa2) |
CNY 4,750.00 |
|
| MR220526L4 | Lenti ORF clone of Apoa2 (mGFP-tagged) - Mouse apolipoprotein A-II (Apoa2) |
CNY 4,750.00 |
