United States
Germany
Japan
United Kingdom
China
Birc5 (NM_009689) Mouse Untagged Clone
CAT＃: MC208134
Birc5 (untagged) - Mouse baculoviral IAP repeat-containing 5 (BIRC5/Survivin), transcript variant 1, (10ug)
CNY 1,800.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A; AAC-11; Api4; s; survivin40; T; TIAP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208134 representing NM_009689
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAGCTCCGGCGCTGCCCCAGATCTGGCAGCTGTACCTCAAGAACTACCGCATCGCCACCTTCAAGA ACTGGCCCTTCCTGGAGGACTGCGCCTGCACCCCAGAGCGAATGGCGGAGGCTGGCTTCATCCACTGCCC TACCGAGAACGAGCCTGATTTGGCCCAGTGTTTTTTCTGCTTTAAGGAATTGGAAGGCTGGGAACCCGAT GACAACCCGATAGAGGAGCATAGAAAGCACTCCCCTGGCTGCGCCTTCCTCACTGTCAAGAAGCAGATGG AAGAACTAACCGTCAGTGAATTCTTGAAACTGGACAGACAGAGAGCCAAGAACAAAATTGCAAAGGAGAC CAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCC TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009689 |
| Insert Size | 423 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009689.2, NP_033819.1 |
| RefSeq Size | 977 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 11799 |
| UniProt ID | O70201 |
| Gene Summary | This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. In humans, gene expression is high during fetal development and in most tumors yet low in adult tissues. Antisense transcripts have been identified in human that regulate this gene's expression. At least three transcript variants encoding distinct isoforms have been found for this gene, although at least one of these transcript variants is a nonsense-mediated decay (NMD) candidate. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1), also known as survivin140, represents the most frequently occurring transcript and it encodes isoform 1. |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Large Amino Acid Transporter 1 Selective Liposomes of l-DOPA Functionalized Amphiphile for Combating Glioblastoma.
,null,
Molecular pharmaceutics
,PubMed ID 28958145
[Birc5]
|
|
Large Aminoacid Transporter 1 Selective Liposomes of L-DOPA Functionalized Amphiphile for Combating Glioblastoma
,Bhunia, S;Vangala, V;Bhattacharya, D;Ravuri, HG;Kuncha∥, M;Chakravarty, S;Sistla∥, R;Chaudhuri, A;,
Mol. Pharmaceutics
[BIRC5]
|
|
The role of survivin in podocyte injury induced by puromycin aminonucleoside
,Li, X;Zhang, X;Li, X;Ding, F;Ding, J;,
Int J Mol Sci 6657-73 15 4. April 2014
,PubMed ID 24747598
[BIRC5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223428 | Birc5 (tGFP-tagged) - Mouse baculoviral IAP repeat-containing 5 (BIRC5/Survivin) transcript variant 1 |
CNY 3,400.00 |
|
| MR223428 | Birc5 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 5 (BIRC5/Survivin), transcript variant 1 |
CNY 1,800.00 |
|
| MR223428L3 | Lenti ORF clone of Birc5 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 5 (BIRC5/Survivin), transcript variant 1 |
CNY 5,890.00 |
|
| MR223428L4 | Lenti ORF clone of Birc5 (mGFP-tagged) - Mouse baculoviral IAP repeat-containing 5 (BIRC5/Survivin), transcript variant 1 |
CNY 5,890.00 |
