Adipoq (NM_009605) Mouse Untagged Clone
CAT#: MC208100
Adipoq (untagged) - Mouse adiponectin, C1Q and collagen domain containing (Adipoq), (10ug)
CNY 3,840.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 30kDa; Acdc; Acrp30; Ad; adipo; apM1; APN; GBP28 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208100 representing NM_009605
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTACTGTTGCAAGCTCTCCTGTTCCTCTTAATCCTGCCCAGTCATGCCGAAGATGACGTTACTACAA CTGAAGAGCTAGCTCCTGCTTTGGTCCCTCCACCCAAGGGAACTTGTGCAGGTTGGATGGCAGGCATCCC AGGACATCCTGGCCACAATGGCACACCAGGCCGTGATGGCAGAGATGGCACTCCTGGAGAGAAGGGAGAG AAAGGAGATGCAGGTCTTCTTGGTCCTAAGGGTGAGACAGGAGATGTTGGAATGACAGGAGCTGAAGGGC CACGGGGCTTCCCCGGAACCCCTGGCAGGAAAGGAGAGCCTGGAGAAGCCGCTTATGTGTATCGCTCAGC GTTCAGTGTGGGGCTGGAGACCCGCGTCACTGTTCCCAATGTACCCATTCGCTTTACTAAGATCTTCTAC AACCAACAGAATCATTATGACGGCAGCACTGGCAAGTTCTACTGCAACATTCCGGGACTCTACTACTTCT CTTACCACATCACGGTGTACATGAAAGATGTGAAGGTGAGCCTCTTCAAGAAGGACAAGGCCGTTCTCTT CACCTACGACCAGTATCAGGAAAAGAATGTGGACCAGGCCTCTGGCTCTGTGCTCCTCCATCTGGAGGTG GGAGACCAAGTCTGGCTCCAGGTGTATGGGGATGGGGACCACAATGGACTCTATGCAGATAACGTCAACG ACTCTACATTTACTGGCTTTCTTCTCTACCATGATACCAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009605 |
Insert Size | 744 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009605.4, NP_033735.3 |
RefSeq Size | 1233 bp |
RefSeq ORF | 744 bp |
Locus ID | 11450 |
UniProt ID | Q60994 |
Gene Summary | Important adipokine involved in the control of fat metabolism and insulin sensitivity, with direct anti-diabetic, anti-atherogenic and anti-inflammatory activities. Stimulates AMPK phosphorylation and activation in the liver and the skeletal muscle, enhancing glucose utilization and fatty-acid combustion. Antagonizes TNF-alpha by negatively regulating its expression in various tissues such as liver and macrophages, and also by counteracting its effects. Inhibits endothelial NF-kappa-B signaling through a cAMP-dependent pathway. May play a role in cell growth, angiogenesis and tissue remodeling by binding and sequestering various growth factors with distinct binding affinities, depending on the type of complex, LMW, MMW or HMW.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227517 | Adipoq (tGFP-tagged) - Mouse adiponectin C1Q and collagen domain containing (Adipoq), (10ug) |
CNY 5,200.00 |
|
MR227517 | Adipoq (Myc-DDK-tagged) - Mouse adiponectin, C1Q and collagen domain containing (Adipoq) |
CNY 3,600.00 |
|
MR227517L3 | Lenti ORF clone of Adipoq (Myc-DDK-tagged) - Mouse adiponectin, C1Q and collagen domain containing (Adipoq) |
CNY 5,890.00 |
|
MR227517L4 | Lenti ORF clone of Adipoq (mGFP-tagged) - Mouse adiponectin, C1Q and collagen domain containing (Adipoq) |
CNY 6,000.00 |