Nabp1 (NM_028696) Mouse Untagged Clone
CAT#: MC208080
Nabp1 (untagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2A (Obfc2a), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 4930434H03Rik; 4930442A21Rik; 4930488J04Rik; 4933440J18Rik; 5830411E10Rik; AI852561 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208080 representing NM_028696
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCACGGGGTCAACGACCCTCCACTTTTTATAAAAGACATTAAGGCCGGACTGAAAAACTTAAATGTCG TCTTTATTGTCCTGGAGATAGGACGAGTGACCAAAACCAAAGACGGCCATGAAGTGAGATCCTGCAAAGT AGCTGATAGAACGGGAAGCATCACTATTTCTGTGTGGGATGAGATCGGAGGGCTCATACAGACAGGGGAT ATTATTCGGTTGACCAGAGGGTATGCATCAATGTGGAAAGGATGCCTGACACTTTATACTGGAAGAGGTG GTGAACTTCAAAAAATTGGAGAATTTTGTATGGTGTATTCAGAAGTGCCAAATTTCAGTGAGCCAAACCC AGATTATAGAGGACAGCAGAATAGAGGGGTACAAAATGAACAGAAGGATAAACTGAGCACCAATACATTT GGACCAGTGGGAAATGGTGATCAGACTGGCCCTGAATCTAGGGGATATCATCTTCCATATGGCAGAAGCA ATGGTCCGGGACCTATCAGTCCACAGCTACCAGGAACACCTAGTAGTCAAACAGTCAGGACCACAATAAG TAACGCCAGAGATCCGAGGAGAGCCTTTAAAAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028696 |
Insert Size | 597 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_028696.3, NP_082972.2 |
RefSeq Size | 2838 bp |
RefSeq ORF | 597 bp |
Locus ID | 109019 |
UniProt ID | Q8BGW5 |
Gene Summary | Component of the SOSS complex, a multiprotein complex that functions downstream of the MRN complex to promote DNA repair and G2/M checkpoint. In the SOSS complex, acts as a sensor of single-stranded DNA that binds to single-stranded DNA, in particular to polypyrimidines. The SOSS complex associates with DNA lesions and influences diverse endpoints in the cellular DNA damage response including cell-cycle checkpoint activation, recombinational repair and maintenance of genomic stability. Required for efficient homologous recombination-dependent repair of double-strand breaks (DSBs) and ATM-dependent signaling pathways (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201986 | Nabp1 (tGFP-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2A (Obfc2a) |
CNY 4,370.00 |
|
MR201986 | Nabp1 (Myc-DDK-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2A (Obfc2a) |
CNY 3,600.00 |
|
MR201986L3 | Lenti ORF clone of Nabp1 (Myc-DDK-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2A (Obfc2a) |
CNY 5,890.00 |
|
MR201986L4 | Lenti ORF clone of Nabp1 (mGFP-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2A (Obfc2a) |
CNY 5,890.00 |