Gdf15 (NM_011819) Mouse Untagged Clone
CAT#: MC208053
Gdf15 (untagged) - Mouse growth differentiation factor 15 (Gdf15), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MIC-; MIC-1; NAG; NAG-1; SBF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208053 representing NM_011819
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCCGCCCGCGCTCCAGGCCCAGCCTCCAGGCGGCTCTCAACTGAGGTTCCTGCTGTTCCTGCTGC TGTTGCTGCTGCTGCTGTCATGGCCATCGCAGGGGGACGCCCTGGCAATGCCTGAACAGCGACCCTCCGG CCCTGAGTCCCAACTCAACGCCGACGAGCTACGGGGTCGCTTCCAGGACCTGCTGAGCCGGCTGCATGCC AACCAGAGCCGAGAGGACTCGAACTCAGAACCAAGTCCTGACCCAGCTGTCCGGATACTCAGTCCAGAGG TGAGATTGGGGTCCCACGGCCAGCTGCTACTCCGCGTCAACCGGGCGTCGCTGAGTCAGGGTCTCCCCGA AGCCTACCGCGTGCACCGAGCGCTGCTCCTGCTGACGCCGACGGCCCGCCCCTGGGACATCACTAGGCCC CTGAAGCGTGCGCTCAGCCTCCGGGGACCCCGTGCTCCCGCATTACGCCTGCGCCTGACGCCGCCTCCGG ACCTGGCTATGCTGCCCTCTGGCGGCACGCAGCTGGAACTGCGCTTACGGGTAGCCGCCGGCAGGGGGCG CCGAAGCGCGCATGCGCACCCAAGAGACTCGTGCCCACTGGGTCCAGGGCGCTGCTGTCACTTGGAGACT GTGCAGGCAACTCTTGAAGACTTGGGCTGGAGCGACTGGGTGCTGTCCCCGCGCCAGCTGCAGCTGAGCA TGTGCGTGGGCGAGTGTCCCCACCTGTATCGCTCCGCGAACACGCATGCGCAGATCAAAGCACGCCTGCA TGGCCTGCAGCCTGACAAGGTGCCTGCCCCGTGCTGTGTCCCCTCCAGCTACACCCCGGTGGTTCTTATG CACAGGACAGACAGTGGTGTGTCACTGCAGACTTATGATGACCTGGTGGCCCGGGGCTGCCACTGCGCTT GA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011819 |
Insert Size | 912 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC067248, AAH67248 |
RefSeq Size | 1104 bp |
RefSeq ORF | 912 bp |
Locus ID | 23886 |
UniProt ID | Q9Z0J7 |
Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. Mice lacking a functional copy of this gene exhibit progressive loss of motor neurons, and more rapid blood clot formation. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204247 | Gdf15 (tGFP-tagged) - Mouse growth differentiation factor 15 (Gdf15) |
CNY 4,000.00 |
|
MR204247 | Gdf15 (Myc-DDK-tagged) - Mouse growth differentiation factor 15 (Gdf15) |
CNY 2,400.00 |
|
MR204247L3 | Lenti ORF clone of Gdf15 (Myc-DDK-tagged) - Mouse growth differentiation factor 15 (Gdf15) |
CNY 4,750.00 |
|
MR204247L4 | Lenti ORF clone of Gdf15 (mGFP-tagged) - Mouse growth differentiation factor 15 (Gdf15) |
CNY 4,800.00 |