United States
Germany
Japan
United Kingdom
China
Hmgb1 (NM_010439) Mouse Untagged Clone
CAT＃: MC208023
Hmgb1 (untagged) - Mouse high mobility group box 1 (Hmgb1), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | amph; HMG-1; Hmg1; p3; p30; SBP; SBP-1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206835 representing BC110667.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCAAAGGAGATCCTAAGAAGCCGAGAGGCAAAATGTCCTCATATGCATTCTTTGTGCAAACTTGC CGGGAGGAGCACAAGAAGAAGCACCCGGATGCTTCTGTCAACTTCTCAGAGTTCTCCAAGAAGTGCTCA GAGAGGTGGAAGACCATGTCTGCTAAAGAAAAGGGGAAATTTGAAGATATGGCAAAGGCTGACAAGGCT CGTTATGAAAGAGAAATGAAAACCTACATCCCCCCCAAAGGGGAGACCAAAAAGAAGTTCAAGGACCCC AATGCACCCAAGAGGCCTCCTTCGGCCTTCTTCTTGTTCTGTTCTGAGTACCGCCCCAAAATCAAAGGC GAGCATCCTGGCTTATCCATTGGTGATGTTGCAAAGAAACTAGGAGAGATGTGGAACAACACTGCAGCA GATGACAAGCAGCCCTATGAGAAGAAAGCTGCCAAGCTGAAGGAGAAGTATGAGAAGGATATTGCTGCC TACAGAGCTAAAGGAAAACCTGATGCAGCGAAAAAGGGGGTGGTCAAGGCTGAAAAGAGCAAGAAAAAG AAGGAAGAGGAAGATGATGAGGAGGATGAAGAGGATGAGGAAGAGGAGGAAGAAGAGGAAGACGAAGAT GAAGAAGAAGATGATGATGATGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010439 |
| Insert Size | 648 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_010439.4, NP_034569.1 |
| RefSeq Size | 2327 bp |
| RefSeq ORF | 648 bp |
| Locus ID | 15289 |
| UniProt ID | P63158 |
| Gene Summary | This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR202375 | Hmgb1 (Myc-DDK-tagged) - Mouse high mobility group box 1 (Hmgb1) |
CNY 3,600.00 |
|
| MR202375L3 | Lenti ORF clone of Hmgb1 (Myc-DDK-tagged) - Mouse high mobility group box 1 (Hmgb1) |
CNY 5,890.00 |
|
| MR202375L4 | Lenti ORF clone of Hmgb1 (mGFP-tagged) - Mouse high mobility group box 1 (Hmgb1) |
CNY 6,000.00 |
