Gstz1 (NM_010363) Mouse Untagged Clone

CAT#: MC208017

Gstz1 (untagged) - Mouse glutathione transferase zeta 1 (maleylacetoacetate isomerase) (Gstz1), (10ug)



  "NM_010363" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MAAI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208017 representing NM_010363
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAGCCGGGAAGCCTATCCTCTACTCCTATTTCCGAAGCTCCTGTTCATGGAGAGTTCGAATTGCTC
TGGCGTTAAAAGGCATTGACTATGAGATAGTGCCCATCAACCTCATAAAGGATGGCGGGCAACAGTTCAC
TGAGGAATTTCAGACCCTGAACCCCATGAAGCAAGTGCCAGCGCTGAAAATTGATGGAATCACCATTGTC
CAGTCACTGGCCATCATGGAGTACCTGGAAGAGACTCGGCCTATCCCACGGCTCCTGCCTCAGGACCCAC
AGAAAAGAGCCATCGTGCGCATGATTTCTGACCTCATCGCTAGTGGCATCCAGCCCCTTCAGAACCTGTC
TGTCCTGAAGCAAGTGGGACAGGAGAACCAGATGCAATGGGCCCAAAAGGTTATTACTTCCGGCTTTAAC
GCTCTGGAGAAGATTCTGCAGAGCACAGCAGGGAAGTACTGCGTAGGAGATGAGGTATCCATGGCTGATG
TGTGCTTAGTACCCCAAGTGGCAAATGCTGAAAGGTTCAAGGTGGATCTAAGCCCCTACCCTACCATCAG
TCACATCAACAAGGAGCTGCTAGCCTTAGAGGTTTTCCAAGTGTCTCACCCCCGTCGACAGCCAGATACC
CCTGCCGAGCTGAGGACTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010363
Insert Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC031777, AAH31777
RefSeq Size 1671 bp
RefSeq ORF 651 bp
Locus ID 14874
UniProt ID Q9WVL0
Gene Summary Probable bifunctional enzyme showing minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1, 3-diazole and maleylacetoacetate isomerase activity. Has also low glutathione peroxidase activity with t-butyl and cumene hydroperoxides. Is able to catalyze the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...