United States
Germany
Japan
United Kingdom
China
Bglap2 (NM_001032298) Mouse Untagged Clone
CAT＃: MC207994
Bglap2 (untagged) - Mouse bone gamma-carboxyglutamate protein 2 (Bglap2), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Bglap1; Bgp; BGP2; mOC-; mOC-B; OG; Og2; oste |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207994 representing NM_001032298
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGACCCTCTCTCTGCTCACTCTGCTGGCCCTGGCTGCGCTCTGTCTCTCTGACCTCACAGATGCCA AGCCCAGCGGCCCTGAGTCTGACAAAGCCTTCATGTCCAAGCAGGAGGGCAATAAGGTAGTGAACAGACT CCGGCGCTACCTTGGAGCCTCAGTCCCCAGCCCAGATCCCCTGGAGCCCACCCGGGAGCAGTGTGAGCTT AACCCTGCTTGTGACGAGCTATCAGACCAGTATGGCTTGAAGACCGCCTACAAACGCATCTACGGTATCA CTATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001032298 |
| Insert Size | 288 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001032298.3, NP_001027469.2 |
| RefSeq Size | 473 bp |
| RefSeq ORF | 288 bp |
| Locus ID | 12097 |
| UniProt ID | P86547 |
| Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a hormone that is secreted by osteoblasts and may function in bone remodeling and energy metabolism. Homozygous knockout mice for this gene exhibit a gradual increase in bone size, density and strength, as well as elevated adiposity and impaired glucose tolerance. This gene is present in a gene cluster with other related genes on chromosome 3. [provided by RefSeq, Aug 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR212133 | Bglap2 (Myc-DDK-tagged) - Mouse bone gamma-carboxyglutamate protein 2 (Bglap2) |
CNY 1,200.00 |
|
| MR212133L3 | Lenti ORF clone of Bglap2 (Myc-DDK-tagged) - Mouse bone gamma-carboxyglutamate protein 2 (Bglap2) |
CNY 4,750.00 |
|
| MR212133L4 | Lenti ORF clone of Bglap2 (mGFP-tagged) - Mouse bone gamma-carboxyglutamate protein 2 (Bglap2) |
CNY 4,750.00 |
