Tmem150b (NM_001142792) Mouse Untagged Clone

CAT#: MC207961

Tmem150b (untagged) - Mouse transmembrane protein 150B (Tmem150b), transcript variant 1, (10ug)



  "NM_001142792" in other vectors (3)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TMEM150B Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A630041N19; Tmem224
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207961 representing NM_001142792
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGAATTACCTGTCCTTGCTGCCTGTCATCTTATTTCTGTGGGCTATAGCTGGCATCTGGATTGTTT
TTGCAATCGCTGTGGTTAATGGTTCTGTGGACCTCAACGAAGGCTTCCCTTTTATCAGTATCTGTGGCTC
TTATGCTCCTCAGAGCTGCATTTTCGGCCAAGTCCTCAATATAGGAGCTGCTCTAACTGTTTGGATCTGC
ATTGTGCGTCATCACCAACTCCGGGACTGGGGCGTCAAAACCTGGCAAAACCAGCTAATTCTGTGGTCGG
GGATCCTTTGTGCCCTGGGTACCTCCATAGTAGGCAACTTCCAGGACAAGAACCAGAAGCCCACACACTT
GGCAGGGGCCTTTCTGGCCTTCATCCTGGGCAACCTGTACTTCTGGCTACAGTTTTTTCTGTCCTGGTGG
GTGAAAGGCCTGCCCCAACCTGGGCCCCACTGGATTAAGTCTCTACGCCTGAGCCTCTGCAGCCTCTCCA
CCATCCTCATCGTGGCTATGATTGTCCTGCACGCCCTACATATGCGCTCTGCCTCGGCTATCTGCGAGTG
GGTAGTGGCCATGTTGCTCTTTATGCTATTTGGCTTCTTTGCCGTGGACTTCTCCATTTTGCGTGGCTGC
ACCCTGCACTTACATCCCCGTCTGGACTCCAGCCTCCCACAAGCTCCCTCTGGGTCTCCAAATATACAGA
TGGCACAGGTGCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001142792
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142792.1, NP_001136264.1
RefSeq Size 1025 bp
RefSeq ORF 717 bp
Locus ID 330460
UniProt ID Q8R218
Gene Summary Modulator of macroautophagy that causes accumulation of autophagosomes under basal conditions and enhances autophagic flux (By similarity). Represses cell death and promotes long-term clonogenic survival of cells grown in the absence of glucose in a macroautophagy-independent manner (By similarity). May have some role in extracellular matrix engulfment or growth factor receptor recycling, both of which can modulate cell survival (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...