Snurf (NM_033174) Mouse Untagged Clone
CAT#: MC207787
Snurf (untagged) - Mouse SNRPN upstream reading frame (Snurf), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2410045I01Rik; Snrpn |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207787 representing NM_033174
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCGAGGAAGGGATCGCTTACACTTGAGAAGAACTACTGAACAGCACGTGCCCGAGGTCGAGGTCC AGGTCAAACGTCGAAGGACAGCCTCACTGAGCAACCAAGAGTGTCACTTGTACCCACGACGTTCTCAGCA ACAGCAAGTTCCTGTGGTGGATTTCCAGGCAGAACTAAGACAGGCATTCTTAGCTGAGACACCAAGAGGT GGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_033174 |
Insert Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033174.3, NP_149409.1 |
RefSeq Size | 1971 bp |
RefSeq ORF | 216 bp |
Locus ID | 84704 |
UniProt ID | Q9WU12 |
Gene Summary | This gene is located within the mouse orthologous Prader-Willi Syndrome critical region and is imprinted and expressed from the paternal allele. This transcipt is thought to be bicistronic and can encode the small nuclear ribonucleoprotein polypeptide N (Snrpn) from a downstream open reading frame. The small protein represented by this gene is encoded by an evolutionarily-conserved upstream open reading frame and is localized to the nucleus. [provided by RefSeq, Mar 2017] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR202962 | Snurf (Myc-DDK-tagged) - Mouse SNRPN upstream reading frame (Snurf) |
CNY 2,400.00 |
|
MR202962L3 | Lenti ORF clone of Snurf (Myc-DDK-tagged) - Mouse SNRPN upstream reading frame (Snurf) |
CNY 4,750.00 |
|
MR202962L4 | Lenti ORF clone of Snurf (mGFP-tagged) - Mouse SNRPN upstream reading frame (Snurf) |
CNY 4,750.00 |