Polr3g (NM_001081176) Mouse Untagged Clone

CAT#: MC207628

Polr3g (untagged) - Mouse polymerase (RNA) III (DNA directed) polypeptide G (Polr3g), (10ug)



  "NM_001081176" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310047G20Rik; AV275904; RPC7; RPC32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207628 representing NM_001081176
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGGCAATAAAGGAAGAGGGCGTGCTGCCTACACCTTTAATATCGAAGCTGTTGGATTCAGCAGAG
GGGAGAAGTTACCTGATGTTGTGTTGAAGCCTCCACCCCTGTTTCCTGATACAGACTACAAGCCGGTGCC
CCTGAAAACGGGAGAAGATGAGGATTACATGCTGGCCTTGAAGCAGGAGTTGAGGGAAACAGTGAAACGA
TTGCCGTACTTTATTGAACCACCCGAAGAAAAACAAGATGATATTGAAAGGTATAGCAAACGATACATGA
AGGTCTATAAAGAAGAATGGGTACCAGATTGGAGAAGACTTCCAAGAGAGATGATGCCAAGGAAAAAATG
CAAAAAAGGGGATCCAAAATCCAAGCCGAGCAAAGCTGCAGCCAAGGCTACATCACTCATTAATTCTGCA
GATGTGTTGAAAACGATTGAGGAACTGGAAAAGAGAGGCGAGGGTGAAAGATCGGATGAAGAAAACGAAG
AGAAAGAAGGGAGCAAAGAGAAAGATAAAGATGATGAGGAGGATGGCGAGGAAGATGCAGAACAGGAGGA
CTACGATGAAGAGGAACAAGAAGAGGAGAATGACTACATTAACTCCTACTTCGACAACGGCGATGATTTT
GGTGTAGACAGCGACGACAACATGGATGAAGCCACCTACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001081176
Insert Size 672 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001081176.1, NP_001074645.1
RefSeq Size 3060 bp
RefSeq ORF 672 bp
Locus ID 67486
UniProt ID Q6NXY9
Gene Summary DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific peripheric component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. May direct with other members of the RPC3/POLR3C-RPC6/POLR3F-RPC7/POLR3G subcomplex RNA Pol III binding to the TFIIIB-DNA complex via the interactions between TFIIIB and POLR3F. May be involved either in the recruitment and stabilization of the subcomplex within RNA polymerase III, or in stimulating catalytic functions of other subunits during initiation. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts induce type I interferon and NF- Kappa-B through the RIG-I pathway.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...