United States
Germany
Japan
United Kingdom
China
Mlst8 (NM_019988) Mouse Untagged Clone
CAT＃: MC207533
Mlst8 (untagged) - Mouse MTOR associated protein, LST8 homolog (S. cerevisiae) (Mlst8), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610033N12Rik; AA409454; AI505104; AI851821; Gbl |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207533 representing NM_019988
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAATACCACCCCAGGCACAGTGGGCAGTGACCCTGTCATCTTAGCAACTGCAGGCTATGACCACACGG TGCGCTTTTGGCAGGCTCACAGTGGAATCTGCACTCGAACAGTGCAGCATCAGGACTCTCAGGTAAATGC ATTGGAGATTACTCCGGACCGAAGCATGATTGCTGCTGCAGGTTACCAACATATCCGCATGTATGATCTC AACTCCAATAACCCCAACCCCATCATCAGTTATGACGGAGTCAGTAAGAACATTGCATCAGTGGGCTTTC ACGAGGATGGTCGCTGGATGTATACAGGTGGCGAGGACTGCACAGCTCGCATCTGGGACCTCAGGTCCCG GAACTTGCAGTGTCAGCGTATCTTCCAGGTGAACGCACCCATTAATTGCGTGTGTCTGCATCCCAACCAG GCAGAACTCATTGTGGGTGATCAGAGCGGTGCTATCCACATCTGGGACCTGAAGACAGACCACAATGAGC AGCTGATTCCCGAGCCTGAGTCTTCCATCACGTCTGCTCACATCGACCCAGATGCTAGCTACATGGCAGC CGTCAATAGTGCCGGAAACTGCTATGTCTGGAACCTGACAGGGGGCATTGGTGACGATGTGACTCAGCTC ATCCCTAAGACCAAGATCCCAGCCCATACACGCTATGCCCTGCAATGCCGCTTCAGCCCTGATTCCACGC TTCTTGCCACCTGTTCAGCTGACCAGACATGTAAAATCTGGAGGACATCCAACTTCTCCCTGATGACAGA GCTTAGCATCAAGAGTAGTAACCCTGGAGAGTCATCCCGTGGCTGGATGTGGGGCTGTGCCTTCTCAGGG GATTCCCAGTACATTGTCACAGCTTCTTCTGACAACCTAGCCCGGCTCTGGTGTGTAGAGACTGGAGAAA TCAAGAGAGAGTATGGTGGCCATCAGAAAGCTGTCGTCTGCTTGGCCTTCAATGACAGTGTGCTGGGTTA G ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019988 |
| Insert Size | 981 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019988.5, NP_064372.2 |
| RefSeq Size | 3361 bp |
| RefSeq ORF | 981 bp |
| Locus ID | 56716 |
| UniProt ID | Q9DCJ1 |
| Gene Summary | Subunit of both mTORC1 and mTORC2, which regulates cell growth and survival in response to nutrient and hormonal signals. mTORC1 is activated in response to growth factors or amino acids. Growth factor-stimulated mTORC1 activation involves a AKT1-mediated phosphorylation of TSC1-TSC2, which leads to the activation of the RHEB GTPase that potently activates the protein kinase activity of mTORC1. Amino acid-signaling to mTORC1 requires its relocalization to the lysosomes mediated by the Ragulator complex and the Rag GTPases. Activated mTORC1 up-regulates protein synthesis by phosphorylating key regulators of mRNA translation and ribosome synthesis. mTORC1 phosphorylates EIF4EBP1 and releases it from inhibiting the elongation initiation factor 4E (eiF4E). mTORC1 phosphorylates and activates S6K1 at 'Thr-389', which then promotes protein synthesis by phosphorylating PDCD4 and targeting it for degradation. Within mTORC1, LST8 interacts directly with MTOR and enhances its kinase activity. In nutrient-poor conditions, stabilizes the MTOR-RPTOR interaction and favors RPTOR-mediated inhibition of MTOR activity. mTORC2 is also activated by growth factors, but seems to be nutrient-insensitive. mTORC2 seems to function upstream of Rho GTPases to regulate the actin cytoskeleton, probably by activating one or more Rho-type guanine nucleotide exchange factors. mTORC2 promotes the serum-induced formation of stress-fibers or F-actin. mTORC2 plays a critical role in AKT1 'Ser-473' phosphorylation, which may facilitate the phosphorylation of the activation loop of AKT1 on 'Thr-308' by PDK1 which is a prerequisite for full activation. mTORC2 regulates the phosphorylation of SGK1 at 'Ser-422'. mTORC2 also modulates the phosphorylation of PRKCA on 'Ser-657'.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204763 | Mlst8 (tGFP-tagged) - Mouse G protein beta subunit-like (Gbl) |
CNY 2,850.00 |
|
| MR204763 | Mlst8 (Myc-DDK-tagged) - Mouse MTOR associated protein, LST8 homolog (S. cerevisiae) (Mlst8) |
CNY 2,400.00 |
|
| MR204763L3 | Lenti ORF clone of Mlst8 (Myc-DDK-tagged) - Mouse MTOR associated protein, LST8 homolog (S. cerevisiae) (Mlst8) |
CNY 4,750.00 |
|
| MR204763L4 | Lenti ORF clone of Mlst8 (mGFP-tagged) - Mouse MTOR associated protein, LST8 homolog (S. cerevisiae) (Mlst8) |
CNY 4,750.00 |
