United States
Germany
Japan
United Kingdom
China
Nupr1 (NM_019738) Mouse Untagged Clone
CAT＃: MC207519
Nupr1 (untagged) - Mouse nuclear protein 1 (Nupr1), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310032H04Rik; Com1; p8 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207519 representing NM_019738
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCACCTTGCCACCAACAGCCAACCCTTCCCAGCAACCTCTAAACCTAGAGGATGAAGATGGAATCC TGGATGAATATGATCAGTACAGCCTGGCCCATCCCTGTGTCGTCGGGGGAGGTCGGAAAGGTCGGACCAA GAGAGAAGCTGCTGCCAATACCAACCGCCCTAGCCCTGGCGGGCATGAGAGGAAGCTGCTGACCAAGTTC CAGAACTCTGAAAGGAAAAAAGCCTGGCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019738 |
| Insert Size | 243 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019738.1, NP_062712.1 |
| RefSeq Size | 639 bp |
| RefSeq ORF | 243 bp |
| Locus ID | 56312 |
| UniProt ID | Q9WTK0 |
| Gene Summary | Transcription regulator that converts stress signals into a program of gene expression that empowers cells with resistance to the stress induced by a change in their microenvironment. Thereby participates in regulation of many process namely cell-cycle, apoptosis, autophagy and DNA repair responses (PubMed:11896600, PubMed:19723804, PubMed:23900510, PubMed:27451286, PubMed:22565310, PubMed:20181828). Controls cell cycle progression and protects cells from genotoxic stress induced by doxorubicin through the complex formation with TP53 and EP300 that binds CDKN1A promoter leading to transcriptional induction of CDKN1A (By similarity). Protects pancreatic cancer cells from stress-induced cell death by binding the RELB promoter and activating its transcription, leading to IER3 transactivation (PubMed:22565310). Negatively regulates apoptosis through interaction with PTMA (By similarity). Inhibits autophagy-induced apoptosis in cardiac cells through FOXO3 interaction, inducing cytoplasmic translocation of FOXO3 thereby preventing the FOXO3 association with the pro-autophagic BNIP3 promoter (PubMed:20181828). Inhibits cell growth and facilitates programmed cell death by apoptosis after adriamycin-induced DNA damage through transactivation of TP53 (PubMed:11896600). Regulates methamphetamine-induced apoptosis and autophagy through DDIT3-mediated endoplasmic reticulum stress pathway (By similarity). Participates to DNA repair following gamma-irradiation by facilitating DNA access of the transcription machinery through interaction with MSL1 leading to inhibition of histone H4' Lys-16' acetylation (H4K16ac) (By similarity). Coactivator of PAX2 transcription factor activity, both by recruiting the EP300 cofactor to increase PAX2 transcription factor activity and by binding PAXIP1 to suppress PAXIP1-induced inhibition on PAX2 (By similarity). Positively regulates cell cycle progression through interaction with COPS5 inducing cytoplasmic translocation of CDKN1B leading to the CDKN1B degradation (By similarity). Coordinates, through its interaction with EP300, the assiociation of MYOD1, EP300 and DDX5 to the MYOG promoter, leading to inhibition of cell-cycle progression and myogenic differentiation promotion (PubMed:19723804). Negatively regulates beta cell proliferation via inhibition of cell-cycle regulatory genes expression through the suppression of their promoter activities (PubMed:23900510). Also required for LHB expression and ovarian maturation (PubMed:18495683). Exacerbates CNS inflammation and demyelination upon cuprizone treatment (PubMed:16374777).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200140 | Nupr1 (tGFP-tagged) - Mouse nuclear protein 1 (Nupr1) |
CNY 2,800.00 |
|
| MR200140 | Nupr1 (Myc-DDK-tagged) - Mouse nuclear protein 1 (Nupr1) |
CNY 1,200.00 |
|
| MR200140L3 | Lenti ORF clone of Nupr1 (Myc-DDK-tagged) - Mouse nuclear protein 1 (Nupr1) |
CNY 4,750.00 |
|
| MR200140L4 | Lenti ORF clone of Nupr1 (mGFP-tagged) - Mouse nuclear protein 1 (Nupr1) |
CNY 4,750.00 |
