Elovl2 (NM_019423) Mouse Untagged Clone

CAT#: MC207505

Elovl2 (untagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 (Elovl2), (10ug)



  "NM_019423" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI317360; Ssc2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207505 representing NM_019423
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCAGCTGAAGGCCTTTGATAATGAAGTCAATGCTTTCTTGGACAACATGTTTGGACCACGAGATT
CTCGAGTTCGCGGGTGGTTCCTGCTGGACTCTTACCTTCCCACCTTCATCCTCACCATCACGTACCTGCT
CTCGATATGGCTGGGTAACAAGTACATGAAGAACAGGCCTGCTCTGTCTCTCAGGGGCATCCTCACCTTG
TATAACCTCGCAATCACACTTCTTTCTGCGTATATGCTGGTGGAGCTCATCCTCTCCAGCTGGGAAGGAG
GTTACAACTTGCAGTGTCAGAATCTCGACAGTGCAGGAGAAGGTGATGTCCGGGTAGCCAAGGTCTTGTG
GTGGTACTACTTCTCCAAACTAGTGGAGTTCCTGGACACGATTTTCTTTGTTCTACGAAAAAAGACCAAT
CAGATCACCTTCCTTCATGTCTATCACCACGCGTCCATGTTCAACATCTGGTGGTGTGTTTTGAACTGGA
TACCTTGTGGTCAAAGCTTCTTTGGACCCACCCTGAACAGCTTTATCCACATTCTCATGTACTCCTACTA
CGGCCTGTCTGTGTTCCCGTCCATGCACAAGTACCTTTGGTGGAAGAAGTACCTCACACAGGCTCAGCTG
GTGCAGTTCGTACTCACCATCACGCACACGCTGAGTGCCGTGGTGAAGCCCTGTGGCTTCCCCTTTGGCT
GTCTCATCTTCCAGTCTTCCTATATGATGACGCTGGTCATCCTGTTCTTAAACTTCTATATTCAGACATA
CCGGAAAAAGCCAGTGAAGAAAGAGCTGCAAGAGAAAGAAGTGAAGAATGGTTTCCCCAAAGCCCACTTA
ATTGTGGCTAATGGCATGACGGACAAGAAGGCTCAATAA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_019423
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_019423.2, NP_062296.1
RefSeq Size 3837 bp
RefSeq ORF 879 bp
Locus ID 54326
UniProt ID Q9JLJ4
Gene Summary Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that catalyzes the synthesis of polyunsaturated very long chain fatty acid (C20- and C22-PUFA), acting specifically toward polyunsaturated acyl-CoA with the higher activity toward C20:4(n-6) acyl-CoA. May participate in the production of polyunsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Essential for the formation of C24:5(n-6) up to C30:5(n-6) PUFAs in testis, these fatty acids being indispensable for normal spermatogenesis and fertility.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...