United States
Germany
Japan
United Kingdom
China
Sirt6 (NM_181586) Mouse Untagged Clone
CAT＃: MC207484
Sirt6 (untagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 1, (10ug)
CNY 5,488.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2810449N18Rik; AI043036; Sir2l6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207484 representing NM_181586
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGTGAATTATGCAGCAGGGTTGTCGCCTTACGCGGATAAGGGCAAGTGCGGGCTGCCCGAGATCT TCGACCCACCAGAGGAGCTGGAACGCAAGGTGTGGGAGCTGGCCCGGCTAATGTGGCAGTCCTCCAGCGT GGTTTTCCACACGGGCGCCGGCATCAGCACCGCCTCTGGCATCCCCGACTTCAGAGGCCCCCATGGCGTG TGGACCATGGAGGAACGCGGCCTGGCCCCCAAGTTTGACACCACCTTCGAGAATGCTCGGCCCTCGAAGA CCCACATGGCCCTGGTTCAGCTAGAACGCATGGGCTTCCTCAGCTTCCTGGTCAGCCAGAACGTAGACGG GCTGCACGTGCGCTCGGGCTTCCCCAGGGACAAGCTGGCAGAGCTGCACGGAAACATGTTTGTAGAGGAA TGTCCCAAGTGTAAGACGCAGTACGTCAGAGACACGGTTGTGGGCACCATGGGCCTCAAGGCCACAGGCC GGCTCTGCACCGTGGCCAAGACCAGGGGACTTCGGGCCTGTAGAGGGGAGCTGAGAGACACCATTCTGGA CTGGGAGGACTCGTTGCCTGACCGGGACCTGATGCTCGCTGATGAGGCCAGCAGGACCGCAGACCTGTCT GTCACCCTGGGTACCTCGCTGCAGATCCGCCCCAGTGGGAACCTGCCCCTTGCCACTAAGCGCCGAGGAG GCCGTCTGGTCATTGTCAACCTGCAACCCACAAAACATGACCGCCAGGCTGACCTGCGCATCCACGGCTA CGTGGATGAGGTGATGTGCAGACTCATGAAGCATCTGGGGCTGGAGATTCCAGCCTGGGATGGACCCTGC GTGCTAGACAAAGCCCTGCCACCTCTGCCTCGCCCAGTAGCACTCAAGGCTGAGCCCCCCGTGCATCTCA ATGGTGCAGTGCATGTTTCGTATAAGTCCAAGCCCAACAGCCCTATACTCCACAGGCCCCCCAAAAGAGT GAAGACCGAGGCTGCCCCCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_181586 |
| Insert Size | 1005 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC052763, AAH52763 |
| RefSeq Size | 1682 bp |
| RefSeq ORF | 1005 bp |
| Locus ID | 50721 |
| UniProt ID | P59941 |
| Gene Summary | NAD-dependent protein deacetylase. Has deacetylase activity towards histone H3K9Ac and H3K56Ac. Modulates acetylation of histone H3 in telomeric chromatin during the S-phase of the cell cycle. Deacetylates histone H3K9Ac at NF-kappa-B target promoters and may down-regulate the expression of a subset of NF-kappa-B target genes. Deacetylation of nucleosomes interferes with RELA binding to target DNA. May be required for the association of WRN with telomeres during S-phase and for normal telomere maintenance. On DNA damage, promotes DNA end resection via deacetylation of RBBP8. Has very weak deacetylase activity and can bind NAD(+) in the absence of acetylated substrate (By similarity). Acts as a corepressor of the transcription factor Hif1a to control the expression of multiple glycolytic genes to regulate glucose homeostasis. Required for genomic stability. Required for normal IGF1 serum levels and normal glucose homeostasis. Modulates cellular senescence and apoptosis. Regulates the production of TNF protein. Has a role in the regulation of life span in male mice, but not in female mice.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204964 | Sirt6 (tGFP-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6) |
CNY 7,088.00 |
|
| MR204964 | Sirt6 (Myc-DDK-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 1 |
CNY 5,488.00 |
|
| MR204964L3 | Lenti ORF clone of Sirt6 (Myc-DDK-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 1 |
CNY 5,890.00 |
|
| MR204964L4 | Lenti ORF clone of Sirt6 (mGFP-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 1 |
CNY 7,888.00 |
