Timm13 (NM_013895) Mouse Untagged Clone

CAT#: MC207478

Timm13 (untagged) - Mouse translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_013895" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Timm13 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms D10Ertd378e; Tim9; Timm9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207478 representing NM_013895
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACAGCGGCTTCGGCTCGGATTTTGGCGGCACGGGTGGCGGGAAGCTGGACCCGGGGGCCATTATGG
AGCAGGTGAAAGTGCAGATCGCCGTGGCCAACGCGCAGGAGCTGCTCCAGAGAATGACGGACAAGTGTTT
CCGGAAGTGCATCGGGAAGCCCGGGGGCTCCTTGGATAACTCGGAGCAGAAATGCATCGCCATGTGCATG
GACCGCTACATGGACGCCTGGAATACCGTGTCCCGCGCCTACAACTCTCGACTGCAGCGGGAACGAGCCA
ACATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013895
Insert Size 288 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013895.4, NP_038923.1
RefSeq Size 1225 bp
RefSeq ORF 288 bp
Locus ID 30055
UniProt ID P62075
Gene Summary Mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. Also required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space. The TIMM8-TIMM13 complex mediates the import of proteins such as TIMM23, SLC25A12/ARALAR1 and SLC25A13/ARALAR2, while the predominant TIMM9-TIMM10 70 kDa complex mediates the import of much more proteins (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...