Dnajb9 (NM_013760) Mouse Untagged Clone

CAT#: MC207471

Dnajb9 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily B, member 9 (Dnajb9), (10ug)



  "NM_013760" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA408011; AA673251; AA673481; AW556981; ERdj4; Mdg1; mDj7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207471 representing NM_013760
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTACTCCACAGTCAGTTTTCGTCTTTGCAATCTGCATTTTAATGATAACAGAATTAATCCTGGCCT
CCAAAAGCTACTATGATATCTTAGGTGTGCCAAAGTCTGCCTCAGAGCGACAAATCAAAAAGGCCTTTCA
CAAATTAGCCATGAAGTACCACCCTGACAAAAATAAAAGCCCTGATGCTGAAGCAAAATTCAGAGAGATT
GCAGAAGCGTATGAAACACTCTCGGATGCCAATAGTCGGAAAGAGTATGACACAATTGGACACAGTGCTT
TTACCAATGGCAAAGGACAAAGAGGCAATGGGAGTCCTTTTGAACAGTCATTTAACTTCAATTTTGATGA
CTTATTTAAAGACTTTAATTTTTTTGGTCAGAACCAAAACACTCGGTCTAAGAAGCATTTTGAAAACCAC
TTCCACACACGCCAGGATGGTTCTAGTAGACAAAGGCATCACTTCCAGGAGTTTTCTTTTGGAGGCGGAT
TGTTTGATGATATGTTTGAAGACATGGAGAAAATGTTTTCTTTTAGTGGCTTTGATACCACCAATCGACA
CACAGTACAGACTGAAAATAGATTTCATGGATCTAGCAAGCACTGCAGGACTGTCACTCAACGAAGAGGA
AATATGGTTACTACATACACTGATTGTTCAGGACAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013760
Insert Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013760.4, NP_038788.2
RefSeq Size 1865 bp
RefSeq ORF 669 bp
Locus ID 27362
UniProt ID Q9QYI6
Gene Summary Co-chaperone for Hsp70 protein HSPA5/BiP that acts as a key repressor of the ERN1/IRE1-mediated unfolded protein response (UPR) (By similarity). J domain-containing co-chaperones stimulate the ATPase activity of Hsp70 proteins and are required for efficient substrate recognition by Hsp70 proteins (PubMed:11836248). In the unstressed endoplasmic reticulum, interacts with the luminal region of ERN1/IRE1 and selectively recruits HSPA5/BiP: HSPA5/BiP disrupts the dimerization of the active ERN1/IRE1 luminal region, thereby inactivating ERN1/IRE1 (By similarity). Also involved in endoplasmic reticulum-associated degradation (ERAD) of misfolded proteins (PubMed:22267725). Required for survival of B-cell progenitors and normal antibody production (PubMed:25222125).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...