Xbp1 (NM_013842) Mouse Untagged Clone

CAT#: MC207445

Xbp1 (untagged) - Mouse X-box binding protein 1 (Xbp1), (10ug)



  "NM_013842" in other vectors (5)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


XBP1 Antibody - middle region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms D11Ertd39e; TREB-5; TREB5; XBP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207445 representing NM_013842
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGGTGGTGGCAGCGGCGCCGAGCGCGGCCACGGCGGCCCCCAAAGTGCTACTCTTATCTGGCCAGC
CCGCCTCCGGCGGCCGGGCGCTGCCGCTCATGGTACCCGGTCCGCGGGCAGCAGGGTCGGAGGCGAGCGG
GACACCGCAGGCTCGCAAGCGGCAGCGGCTCACGCACCTGAGCCCGGAGGAGAAAGCGCTGCGGAGGAAA
CTGAAAAACAGAGTAGCAGCGCAGACTGCTCGAGATAGAAAGAAAGCCCGGATGAGCGAGCTGGAGCAGC
AAGTGGTGGATTTGGAAGAAGAGAACCACAAACTCCAGCTAGAAAATCAGCTTTTACGGGAGAAAACTCA
CGGCCTTGTGGTTGAGAACCAGGAGTTAAGAACACGCTTGGGAATGGACACGCTGGATCCTGACGAGGTT
CCAGAGGTGGAGGCCAAGGGGAGTGGAGTAAGGCTGGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGAC
TATGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCTCCCCAGAACATCTTCCCATGGACTCTGAC
ACTGTTGCCTCTTCAGATTCTGAGTCTGATATCCTTTTGGGCATTCTGGACAAGTTGGACCCTGTCATGT
TTTTCAAATGTCCTTCCCCAGAGTCTGCTAGTCTGGAGGAACTCCCAGAGGTCTACCCAGAAGGACCTAG
TTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACCTCATCAGCCAAGCTGGAAGCCATTAATGAACTC
ATTCGTTTTGACCATGTATACACCAAGCCTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013842
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC029197, AAH29197
RefSeq Size 1797 bp
RefSeq ORF 804 bp
Locus ID 22433
UniProt ID O35426
Gene Summary Functions as a transcription factor during endoplasmic reticulum stress by regulating the unfolded protein response (UPR). Required for cardiac myogenesis and hepatogenesis during embryonic development and the development of secretory tissues such as exocrine pancreas and salivary gland (PubMed:10425189, PubMed:10652269, PubMed:16362047, PubMed:17612490). Involved in differentiation of B lymphocytes to plasma cells and production of immunoglobulins. Modulates the cellular response to ER stress in a PIK3R-dependent manner. Binds to the cis-acting X box present in the promoter regions of major histocompatibility complex class II genes (By similarity). Involved in VEGF-induced endothelial cell (EC) proliferation and retinal blood vessel formation during embryonic development but also for angiogenesis in adult tissues under ischemic conditions (PubMed:23529610). Functions also as a major regulator of the UPR in obesity-induced insulin resistance and type 2 diabetes for the management of obesity and diabetes prevention (PubMed:15486293).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform, XBP1(U). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...