Ccl12 (NM_011331) Mouse Untagged Clone
CAT#: MC207390
Ccl12 (untagged) - Mouse chemokine (C-C motif) ligand 12 (Ccl12), (10ug)
CNY 1,320.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MCP-5; Scya12 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207390 representing NM_011331
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGATTTCCACACTTCTATGCCTCCTGCTCATAGCTACCACCATCAGTCCTCAGGTATTGGCTGGAC CAGATGCGGTGAGCACCCCAGTCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCCGGAAGCT GAAGAGCTACAGGAGAATCACAAGCAGCCAGTGTCCCCGGGAAGCTGTGATCTTCAGGACCATACTGGAT AAGGAGATCTGTGCTGACCCCAAGGAGAAGTGGGTTAAGAATTCCATAAACCACTTGGATAAGACGTCTC AAACCTTCATCCTTGAACCTTCATGTCTAGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011331 |
Insert Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_011331.2, NP_035461.2 |
RefSeq Size | 537 bp |
RefSeq ORF | 315 bp |
Locus ID | 20293 |
UniProt ID | Q62401 |
Gene Summary | Chemotactic factor that attracts eosinophils, monocytes, and lymphocytes but not neutrophils. Potent monocyte active chemokine that signals through CCR2. Involved in allergic inflammation and the host response to pathogens and may play a pivotal role during early stages of allergic lung inflammation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200255 | Ccl12 (tGFP-tagged) - Mouse chemokine (C-C motif) ligand 12 (Ccl12) |
CNY 2,850.00 |
|
MR200255 | Ccl12 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 12 (Ccl12) |
CNY 1,200.00 |
|
MR200255L3 | Lenti ORF clone of Ccl12 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 12 (Ccl12) |
CNY 4,750.00 |
|
MR200255L4 | Lenti ORF clone of Ccl12 (mGFP-tagged) - Mouse chemokine (C-C motif) ligand 12 (Ccl12) |
CNY 4,750.00 |