Rab11b (NM_008997) Mouse Untagged Clone

CAT#: MC207370

Rab11b (untagged) - Mouse RAB11B, member RAS oncogene family (Rab11b), (10ug)



  "NM_008997" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A730055L17Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207370 representing NM_008997
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGACCCGGGACGACGAGTACGATTACCTATTCAAAGTGGTGCTTATTGGGGACTCAGGTGTAGGTA
AGAGCAACCTGCTGTCACGCTTCACCAGAAACGAATTCAACCTAGAGAGCAAGAGTACCATCGGAGTGGA
GTTCGCCACTCGCAGCATTCAGGTGGACGGCAAGACCATCAAGGCTCAGATCTGGGACACTGCTGGCCAG
GAGCGCTACCGTGCCATTACCTCTGCGTACTACCGTGGTGCAGTGGGTGCACTGCTGGTATATGACATTG
CCAAGCACTTGACATATGAGAACGTGGAGCGCTGGCTGAAGGAGCTGCGGGATCATGCAGATAGCAACAT
TGTCATCATGCTGGTGGGCAACAAGAGTGACCTGCGCCACCTTCGGGCTGTGCCCACTGATGAGGCCCGT
GCCTTTGCAGAAAAGAACAACTTGTCCTTCATTGAGACCTCAGCCTTGGATTCCACCAATGTAGAGGAAG
CATTCAAGAACATCCTCACAGAAATCTACCGTATTGTGTCACAGAAGCAAATCGCTGACCGTGCAGCCCA
CGATGAGTCCCCTGGCAACAACGTGGTGGACATCAGTGTGCCACCCACCACCGATGGACAGAGACCCAAC
AAGCTGCAGTGCTGCCAGAGCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008997
Insert Size 657 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008997.3, NP_033023.1
RefSeq Size 6065 bp
RefSeq ORF 657 bp
Locus ID 19326
UniProt ID P46638
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. The small Rab GTPase RAB11B plays a role in endocytic recycling, regulating apical recycling of several transmembrane proteins including cystic fibrosis transmembrane conductance regulator/CFTR, epithelial sodium channel/ENaC, potassium voltage-gated channel, and voltage-dependent L-type calcium channel. May also regulate constitutive and regulated secretion, like insulin granule exocytosis. Required for melanosome transport and release from melanocytes. Also regulates V-ATPase intracellular transport in response to extracellular acidosis.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...