Ptp4a2 (NM_008974) Mouse Untagged Clone

CAT#: MC207368

Ptp4a2 (untagged) - Mouse protein tyrosine phosphatase 4a2 (Ptp4a2), transcript variant 1, (10ug)



  "NM_008974" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Prl-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207368 representing NM_008974
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACCGTCCAGCCCCTGTGGAGATCTCTTATGAGAACATGCGTTTTCTGATAACTCACAACCCCACCA
ATGCGACTCTCAACAAGTTCACAGAGGAACTTAAGAAGTACGGAGTGACAACTTTGGTTCGAGTTTGTGA
TGCTACATATGATAAAGCTCCAGTTGAAAAAGAAGGAATCCACGTTCTAGATTGGCCGTTTGATGATGGA
GCTCCACCCCCTAATCAGATAGTAGATGATTGGCTAAACCTGTTAAAAACCAAATTTCGTGAAGAGCCAG
GCTGTTGTGTTGCAGTGCATTGTGTTGCAGGATTGGGAAGGGCTCCTGTGCTAGTTGCGCTTGCATTGAT
TGAATGCGGAATGAAGTATGAAGATGCTGTTCAATTTATAAGACAAAAAAGAAGAGGAGCATTCAATTCC
AAACAGCTGCTTTACTTGGAGAAGTACCGACCTAAGATGCGGTTACGCTTCAGAGATACCAATGGGCACT
GCTGTGTTCAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008974
Insert Size 504 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008974.4, NP_033000.1
RefSeq Size 3413 bp
RefSeq ORF 504 bp
Locus ID 19244
UniProt ID O70274
Gene Summary Protein tyrosine phosphatase which stimulates progression from G1 into S phase during mitosis. Inhibits geranylgeranyl transferase type II activity by blocking the association between RABGGTA and RABGGTB (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...