Ntf3 (NM_008742) Mouse Untagged Clone
CAT#: MC207340
Ntf3 (untagged) - Mouse neurotrophin 3 (Ntf3), transcript variant 3, (10ug)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI316846; AI835689; HDNF; NGF-2; NT; NT-; Nt3; Ntf-; Ntf-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207340 representing NM_008742
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCATCTTGTTTTATGTGATATTTCTTGCTTATCTCCGTGGCATCCAAGGCAACAGCATGGATCAAA GGAGTTTGCCGGAAGACTCTCTCAATTCCCTCATCATCAAGCTGATCCAGGCGGATATCTTGAAAAACAA GCTTTCCAAACAGATGGTGGATGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCAGAGGCACCCAGG GAACCAGAGCAGGGAGAGGCCACCAGGTCAGAGTTCCAGCCAATGATTGCAACGGACACAGAGCTACTAC GGCAACAGAGACGCTACAATTCGCCCCGGGTCCTGCTGAGTGACAGCACCCCTTTGGAGCCCCCTCCCTT ATACCTAATGGAGGATTATGTGGGCAACCCGGTGGTAGCCAATAGAACCTCACCACGGAGGAAACGCTAT GCAGAACATAAGAGTCACCGAGGAGAGTACTCAGTGTGTGACAGTGAGAGCCTGTGGGTGACCGACAAGT CCTCAGCCATTGACATTCGGGGACACCAGGTCACAGTGCTGGGGGAGATCAAAACCGGTAACTCTCCTGT GAAACAATATTTTTATGAAACGAGATGTAAAGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGGATTGAT GACAAACACTGGAACTCTCAGTGCAAAACTTCGCAAACCTATGTCCGAGCACTGACTTCAGAAAACAACA AACTCGTAGGCTGGCGCTGGATACGAATAGACACTTCCTGTGTGTGTGCCTTGTCGAGAAAAATTGGAAG AACATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_008742 |
Insert Size | 777 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_008742.3, NP_032768.1 |
RefSeq Size | 1342 bp |
RefSeq ORF | 777 bp |
Locus ID | 18205 |
UniProt ID | P20181 |
Gene Summary | This gene encodes a member of the neurotrophins that have a wide variety of functions in both neural and non-neural tissues. The encoded preproprotein undergoes proteolytic processing to generate a noncovalently linked homodimeric mature protein that can bind to the transmembrane receptor tyrosine kinases to initiate a series of signaling events. Mice lacking the encoded protein exhibit severe defects in the peripheral nervous system including a complete lack of spinal proprioceptive afferents and their peripheral sense organs. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (3) lacks a portion of the 5' UTR and 5' coding region, and uses a downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203333 | Ntf3 (tGFP-tagged) - Mouse neurotrophin 3 (Ntf3) |
CNY 5,200.00 |
|
MR203333 | Ntf3 (Myc-DDK-tagged) - Mouse neurotrophin 3 (Ntf3), transcript variant 3 |
CNY 3,600.00 |
|
MR203333L3 | Lenti ORF clone of Ntf3 (Myc-DDK-tagged) - Mouse neurotrophin 3 (Ntf3), transcript variant 3 |
CNY 5,890.00 |
|
MR203333L4 | Lenti ORF clone of Ntf3 (mGFP-tagged) - Mouse neurotrophin 3 (Ntf3), transcript variant 3 |
CNY 5,890.00 |