United States
Germany
Japan
United Kingdom
China
Nme2 (NM_008705) Mouse Untagged Clone
CAT＃: MC207337
Nme2 (untagged) - Mouse non-metastatic cells 2, protein (NM23B) expressed in (Nme2), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | NM23-H2; nm23-M2; NM23B |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207337 representing NM_008705
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAACCTCGAGCGTACCTTCATTGCCATCAAGCCAGATGGCGTGCAGCGCGGCCTGGTGGGCGAGA TCATCAAACGGTTCGAGCAGAAGGGGTTCCGCCTGGTGGCCATGAAGTTCCTTCGGGCCTCTGAAGAACA CCTGAAGCAGCATTACATCGACCTGAAAGACCGTCCTTTCTTCCCGGGGCTGGTGAAGTACATGAACTCG GGGCCCGTGGTGGCCATGGTCTGGGAGGGGCTCAATGTGGTGAAAACGGGCCGAGTGATGCTGGGGGAGA CCAATCCAGCTGATTCAAAACCAGGCACCATCCGTGGGGATTTCTGCATTCAAGTTGGCAGGAACATCAT TCATGGCAGTGATTCAGTGGAGAGTGCTGAGAAAGAGATCCATCTGTGGTTTAAGCCCGAAGAACTGATC GACTACAAGTCTTGTGCCCATGACTGGGTGTACGAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008705 |
| Insert Size | 459 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_008705.5, NP_032731.1 |
| RefSeq Size | 1027 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 18103 |
| UniProt ID | Q01768 |
| Gene Summary | Major role in the synthesis of nucleoside triphosphates other than ATP. The ATP gamma phosphate is transferred to the NDP beta phosphate via a ping-pong mechanism, using a phosphorylated active-site intermediate (By similarity). Negatively regulates Rho activity by interacting with AKAP13/LBC. Acts as a transcriptional activator of the MYC gene; binds DNA non-specifically. Binds to both single-stranded guanine- and cytosine-rich strands within the nuclease hypersensitive element (NHE) III(1) region of the MYC gene promoter. Does not bind to duplex NHE III(1). Has G-quadruplex (G4) DNA-binding activity, which is independent of its nucleotide-binding and kinase activity. Binds both folded and unfolded G4 with similar low nanomolar affinities. Stabilizes folded G4s regardless of whether they are prefolded or not. Exhibits histidine protein kinase activity (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) and variant 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201106 | Nme2 (tGFP-tagged) - Mouse expressed in non-metastatic cells 2, protein (Nme2), transcript variant 1 |
CNY 2,800.00 |
|
| MR201106 | Nme2 (Myc-DDK-tagged) - Mouse non-metastatic cells 2, protein (NM23B) expressed in (Nme2), transcript variant 1 |
CNY 1,200.00 |
|
| MR201106L3 | Lenti ORF clone of Nme2 (Myc-DDK-tagged) - Mouse non-metastatic cells 2, protein (NM23B) expressed in (Nme2), transcript variant 1 |
CNY 4,750.00 |
|
| MR201106L4 | Lenti ORF clone of Nme2 (mGFP-tagged) - Mouse non-metastatic cells 2, protein (NM23B) expressed in (Nme2), transcript variant 1 |
CNY 4,750.00 |
