United States
Germany
Japan
United Kingdom
China
Nme1 (NM_008704) Mouse Untagged Clone
CAT＃: MC207336
Nme1 (untagged) - Mouse non-metastatic cells 1, protein (NM23A) expressed in (Nme1), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AL024257; NDPK-A; NM23-M1; NM23A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207336 representing NM_008704
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAACAGTGAGCGCACCTTCATTGCCATCAAGCCTGATGGGGTCCAGCGGGGGCTGGTGGGCGAGA TCATCAAGCGGTTCGAGCAGAAGGGGTTCCGCCTTGTTGGTCTGAAGTTTCTGCAGGCTTCAGAGGACCT TCTCAAGGAGCACTACACTGACCTGAAGGACCGCCCCTTCTTTACTGGCCTGGTGAAATACATGCACTCA GGACCAGTGGTTGCTATGGTCTGGGAGGGTCTGAATGTGGTGAAGACAGGCCGCGTGATGCTTGGAGAGA CCAACCCCGCAGACTCTAAGCCTGGGACCATACGAGGAGACTTCTGCATCCAAGTTGGCAGGAACATCAT TCATGGCAGCGATTCTGTAAAGAGCGCAGAGAAGGAGATCAGCTTGTGGTTTCAGCCTGAGGAGCTGGTG GAGTACAAGAGCTGTGCGCAGAACTGGATCTATGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008704 |
| Insert Size | 459 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_008704.2, NP_032730.1 |
| RefSeq Size | 1235 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 18102 |
| UniProt ID | P15532 |
| Gene Summary | Major role in the synthesis of nucleoside triphosphates other than ATP. The ATP gamma phosphate is transferred to the NDP beta phosphate via a ping-pong mechanism, using a phosphorylated active-site intermediate. Possesses nucleoside-diphosphate kinase, serine/threonine-specific protein kinase, geranyl and farnesyl pyrophosphate kinase, histidine protein kinase and 3'-5' exonuclease activities. Involved in cell proliferation, differentiation and development, signal transduction, G protein-coupled receptor endocytosis, and gene expression. Required for neural development including neural patterning and cell fate determination. During GZMA-mediated cell death, works in concert with TREX1. NME1 nicks one strand of DNA and TREX1 removes bases from the free 3' end to enhance DNA damage and prevent DNA end reannealing and rapid repair (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR201104 | Nme1 (Myc-DDK-tagged) - Mouse non-metastatic cells 1, protein (NM23A) expressed in (Nme1) |
CNY 1,200.00 |
|
| MR201104L3 | Lenti ORF clone of Nme1 (Myc-DDK-tagged) - Mouse non-metastatic cells 1, protein (NM23A) expressed in (Nme1) |
CNY 4,750.00 |
|
| MR201104L4 | Lenti ORF clone of Nme1 (mGFP-tagged) - Mouse non-metastatic cells 1, protein (NM23A) expressed in (Nme1) |
CNY 4,750.00 |
