United States
Germany
Japan
United Kingdom
China
Kcne1 (NM_008424) Mouse Untagged Clone
CAT＃: MC207311
Kcne1 (untagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, member 1 (Kcne1), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Isk; MinK; nmf190 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207311 representing NM_008424
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCCTGCCCAATTCCACGACTGTTCTGCCCTTTCTGGCCAGGCTGTGGCAGGAGACAGCTGAACAGG GCGGCAACGTGTCCGGCCTGGCTCGTAAGTCTCAGCTCCGAGATGACAGCAAGCTAGAGGCGCTCTACAT CCTCATGGTGCTGGGCTTCTTCGGCTTCTTCACCCTGGGCATCATGCTGAGTTACATCCGATCCAAGAAG CTGGAGCACTCCCACGACCCTTTCAACGTGTACATCGAGTCAGATGCCTGGCAGGAGAAAGGCAAGGCCG TCTTCCAGGCCCGTGTCCTGGAGAGCTTCAGAGCTTGCTATGTCATTGAAAACCAGGCGGCCGTAGAGCA GCCTGCCACACACCTTCCTGAACTGAAGCCATTGTCGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008424 |
| Insert Size | 390 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_008424.3, NP_032450.1 |
| RefSeq Size | 3155 bp |
| RefSeq ORF | 390 bp |
| Locus ID | 16509 |
| UniProt ID | P23299 |
| Gene Summary | Ancillary protein that assembles as a beta subunit with a voltage-gated potassium channel complex of pore-forming alpha subunits. Modulates the gating kinetics and enhances stability of the channel complex. Assembled with KCNB1 modulates the gating characteristics of the delayed rectifier voltage-dependent potassium channel KCNB1. Assembled with KCNQ1/KVLQT1 is proposed to form the slowly activating delayed rectifier cardiac potassium (IKs) channel. The outward current reaches its steady state only after 50 seconds. Assembled with KCNH2/HERG may modulate the rapidly activating component of the delayed rectifying potassium current in heart (IKr).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200709 | Kcne1 (tGFP-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, member 1 (Kcne1) |
CNY 2,850.00 |
|
| MR200709 | Kcne1 (Myc-DDK-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, member 1 (Kcne1) |
CNY 1,200.00 |
|
| MR200709L3 | Lenti ORF clone of Kcne1 (Myc-DDK-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, member 1 (Kcne1) |
CNY 4,750.00 |
|
| MR200709L4 | Lenti ORF clone of Kcne1 (mGFP-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, member 1 (Kcne1) |
CNY 4,750.00 |
