Gpx1 (NM_008160) Mouse Untagged Clone
CAT#: MC207295
Gpx1 (untagged) - Mouse glutathione peroxidase 1 (Gpx1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Synonyms | AI195024; AL033363; CGP; CGPx; Gp; Gpx; GPx-; GPx-1; GSHPx; GSHPx-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207295 representing NM_008160
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGTGCTGCTCGGCTCTCCGCGGCGGCACAGTCCACCGTGTATGCCTTCTCCGCGCGCCCGCTGACGG GCGGGGAGCCTGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGAATGTCGCGTCTCTCTG AGGCACCACGATCCGGGACTACACCGAGATGAACGATCTGCAGAAGCGTCTGGGACCTCGTGGACTGGTG GTGCTCGGTTTCCCGTGCAATCAGTTCGGACACCAGGAGAATGGCAAGAATGAAGAGATTCTGAATTCCC TCAAGTACGTCCGACCTGGTGGCGGGTTCGAGCCCAATTTTACATTGTTTGAGAAGTGCGAAGTGAATGG TGAGAAGGCTCACCCGCTCTTTACCTTCCTGCGGAATGCCTTGCCAACACCCAGTGACGACCCCACTGCG CTCATGACCGACCCCAAGTACATCATTTGGTCTCCGGTGTGCCGCAACGACATTGCCTGGAACTTTGAGA AGTTCCTGGTGGGCCCCGACGGTGTTCCCGTGCGCAGGTACAGCCGCCGCTTTCGTACCATCGACATCGA ACCTGACATAGAAACCCTGCTGTCCCAGCAGTCTGGCAACTCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008160 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008160.6, NP_032186.2 |
RefSeq Size | 1066 bp |
RefSeq ORF | 606 bp |
Locus ID | 14775 |
UniProt ID | P11352 |
Gene Summary | The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Knockout mice lacking this gene are highly sensitive to oxidants, and develop mature cataracts due to damage to the eye lens nucleus. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202058 | Gpx1 (GFP-tagged) - Mouse glutathione peroxidase 1 (Gpx1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 2,850.00 |
|
MR202058 | Gpx4 (Myc-DDK-tagged) - Mouse glutathione peroxidase 4 (cDNA clone MGC:118087 IMAGE:4936866), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 2,081.00 |