Csrp1 (NM_007791) Mouse Untagged Clone
CAT#: MC207254
Csrp1 (untagged) - Mouse cysteine and glycine-rich protein 1 (Csrp1), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA408841; AA959891; AW545626; CRP1; Csrp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207254 representing NM_007791
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCAAACTGGGGAGGAGGCAAGAAATGTGGGGTATGCCAGAAGACGGTCTACTTTGCTGAGGAGGTCC AGTGCGAGGGCAACAGCTTCCATAAATCCTGCTTCCTGTGTATGGTCTGCAAGAAGAATCTGGACAGCAC CACCGTGGCAGTGCATGGAGAAGAGATCTATTGCAAGTCATGTTACGGCAAGAAGTATGGGCCAAAAGGC TACGGCTACGGGCAGGGCGCAGGCACGCTGAGCACAGACAAGGGGGAGTCTCTGGGCATCAAGCATGAGG AAGCCCCTGGACACAGGCCCACCACCAACCCCAATGCATCCAAGTTTGCCCAGAAGATTGGCGGCTCTGA GCGCTGTCCCCGCTGTAGCCAGGCGGTCTATGCTGCGGAGAAGGTGATCGGTGCCGGGAAGTCCTGGCAT AAGTCCTGCTTCCGATGTGCCAAGTGTGGCAAAGGCCTTGAGTCGACCACCCTGGCAGACAAGGATGGTG AGATCTACTGTAAAGGATGCTATGCCAAAAACTTTGGGCCCAAAGGTTTTGGCTTTGGACAGGGAGCTGG AGCCTTGGTTCACTCAGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007791 |
Insert Size | 582 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007791.5, NP_031817.1 |
RefSeq Size | 1770 bp |
RefSeq ORF | 582 bp |
Locus ID | 13007 |
UniProt ID | P97315 |
Gene Summary | Could play a role in neuronal development.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201873 | Csrp1 (tGFP-tagged) - Mouse cysteine and glycine-rich protein 1 (Csrp1) |
CNY 5,200.00 |
|
MR201873 | Csrp1 (Myc-DDK-tagged) - Mouse cysteine and glycine-rich protein 1 (Csrp1) |
CNY 3,600.00 |
|
MR201873L3 | Lenti ORF clone of Csrp1 (Myc-DDK-tagged) - Mouse cysteine and glycine-rich protein 1 (Csrp1) |
CNY 5,890.00 |
|
MR201873L4 | Lenti ORF clone of Csrp1 (mGFP-tagged) - Mouse cysteine and glycine-rich protein 1 (Csrp1) |
CNY 5,890.00 |