Pam16 (NM_025571) Mouse Untagged Clone
CAT#: MC207212
Pam16 (untagged) - Mouse presequence translocase-asssociated motor 16 homolog (S. cerevisiae) (Pam16), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2010110I09Rik; AV006767; CGI-136; Magmas; Tim16; Timm16 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207212 representing NM_025571
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAAGTACCTGGCCCAGATCATTGTGATGGGTGTGCAGGTGGTGGGCAGAGCCTTTGCCAGGGCCC TGAGGCAGGAGTTTGCAGCCAGCCAGGCAGCCGCTGACGCTCGAGGGCGTGCTGGGCACCAGTCTGCAGC TGCATCCAATCTCTCTGGCCTCAGCCTCCAGGAAGCCCAGCAGATTCTCAACGTCTCCAAGCTGAGCCCC GAGGAGGTCCAGAAGAATTATGAACACCTATTTAAAGTGAATGATAAGTCCGTGGGTGGCTCTTTCTACC TGCAGTCAAAGGTTGTCCGTGCAAAGGAACGTCTAGATGAGGAACTCCGAATACAAGCCCAGGAAGACAG AGAGAAAGGGCAGAAGCCCAAAACGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_025571 |
Insert Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_025571.1, NP_079847.1 |
RefSeq Size | 552 bp |
RefSeq ORF | 378 bp |
Locus ID | 66449 |
UniProt ID | Q9CQV1 |
Gene Summary | Regulates ATP-dependent protein translocation into the mitochondrial matrix. Inhibits DNAJC19 stimulation of HSPA9/Mortalin ATPase activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC201789 | Pam16 (untagged) - Mouse presequence translocase-asssociated motor 16 homolog (S. cerevisiae) (Pam16), nuclear gene encoding mitochondrial protein, (10ug) |
CNY 1,200.00 |
|
MG200652 | Pam16 (tGFP-tagged) - Mouse mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal |
CNY 3,420.00 |
|
MG220285 | Pam16 (tGFP-tagged) - Mouse mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction (Magmas) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2,090.00 |
|
MR220285 | Pam16 (Myc-DDK-tagged) - Mouse presequence translocase-asssociated motor 16 homolog (S. cerevisiae) (Pam16), nuclear gene encoding mitochondrial protein |
CNY 1,900.00 |
|
MR220285L3 | Lenti ORF clone of Pam16 (Myc-DDK-tagged) - Mouse presequence translocase-asssociated motor 16 homolog (S. cerevisiae) (Pam16), nuclear gene encoding mitochondrial protein |
CNY 3,800.00 |
|
MR220285L4 | Lenti ORF clone of Pam16 (mGFP-tagged) - Mouse presequence translocase-asssociated motor 16 homolog (S. cerevisiae) (Pam16), nuclear gene encoding mitochondrial protein |
CNY 3,800.00 |