2700059D21Rik (BC082305) Mouse Untagged Clone

CAT#: MC207197

2700059D21Rik (untagged) - Mouse RIKEN cDNA 2700059D21 gene (cDNA clone MGC:90611 IMAGE:30354830), (10ug)



  "BC082305" in other vectors (4)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Akirin2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MGC90611
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC082305
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTGCGGAGCCACTCTGAAAAGGACTCTGGATTTCGACCCGCTGCTGAGCCCCGCATCTCCGAAGC
GGAGGCGGTGCGCGCCTTTGTCGGCGCCGGCTTCGGCTGCCGCCTCCCCTGCCGCCGCCACCGCCGCCGC
CGCCGCCTCGGCCGCGGCCGCCTCGCCGCAGAAGTATCTCCGGATGGAGCCTTCCCCCTTCGGCGACGTC
TCTTCCCGGCTCACCACAGAACAAATTCTGTACAACATAAAACAGGAATATAAACGCATGCAGAAGAGAA
GACATTTAGAAGCTAGTTTTCAGCAGGCAGATCCAGGTTGTACTTCCGATTCACAGCCACATGCATTTCT
CATCAGTGGACCAGCATCACCAGGTAATAACCCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC082305
Insert Size 3637 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC082305
RefSeq Size 4096 bp
RefSeq ORF 386 bp
Locus ID 433693
Gene Summary Forms a complex with YWHAB that acts to repress transcription of DUSP1 (By similarity). Required for embryonic development and the innate immune response. Downstream effector of the Toll-like receptor (TLR), TNF and IL-1 beta signaling pathways leading to the production of IL-6.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...