Pym1 (NM_001170869) Mouse Untagged Clone

CAT#: MC207151

Wibg (untagged) - Mouse within bgcn homolog (Drosophila) (Wibg), transcript variant 2, (10ug)



  "NM_001170869" in other vectors (3)

CNY 3,230.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A030010B05Rik; Pym; Wibg
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207151 representing NM_001170869
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACTCCCTATGTAACTGACGAGACCGGCGGCAAGTACATTGCCTCAACACAGAGACCCGACGGGA
CGTGGCGAAAGCAGCGGAGGGTCAAAGAAGGATACGTGCCCCAAGAGGAGGTCCCAGTCTATGAAAACAA
GTATGTGAAGTTTTTCAAGAGTAAACCAGAACTTCCCCCAGGGCTGAGCCCTGAGGCCACCACACCGGTC
ACCCCATCCAGACCTGAAGGTGGTGAGACAGGCCTCTCCAAGACAGCCAAACGAAACCTGAAGCGGAAGG
AGAAGAGGCGGCAGCAACAGGAGAAAGAAGCAGAGGCCTTGAGCAGGACTCTTGATAAGGTGTCTCTGGG
AGACACAGCCCAGATACCTAGTGCTCTCCAAGGCCCCCAGGCCACGCCTCTAGCTGCCTCTGATCCATCC
GACTCTGCTGCCACCACAGAGAAAGCCAAGAAGATCAAGAACCTGAGGAAGAAGCTTCGGCAGGTGGAGG
AGCTGCAGCAACGCATCCAGGCCGGGGAGGTCAGCCAGCCCAGCAGAGAACAGCTGGAGAAGCTGGCTCG
ACGGAGGGTTCTGGAGGAGGAGCTGGAGGACTTGGAGTTGGGCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001170869
Insert Size 609 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001170869.2, NP_001164340.1
RefSeq Size 1165 bp
RefSeq ORF 609 bp
Locus ID 78428
UniProt ID Q8CHP5
Gene Summary Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate 5' exon and thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...