Bloc1s2 (NM_028607) Mouse Untagged Clone
CAT#: MC207134
Bloc1s2 (untagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 2 (Bloc1s2), (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2410089B13Rik; Bloc1s2a; BLOS2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207134 representing NM_028607
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGGCTGCGGAGGGCGTCCCGGCGACGCGACGGGAGGAGCAGCCACCTCGAGATGATGCTGCGG TGGAGACAGCCGAGGAAGCAAAGGAGCCTGCCGAAGCTGACATCAATGAGCTCTGCCGGGACATGTTCTC CAAAATGGCCACATATTTGACTGGGGAACTGACAGCCACCAGTGAAGACTACAAACTCCTGGAAAATATG AATAAGCTAACAAGCTTGAAGTACCTTGAAATGAAAGATATTGCTATCAACATCAGCAGAAACCTGAAGG ACTTAAACCAGAAATATGCTGAACTACAGCCATATCTGGACCAGATCAACATGATTGAGGAGCAGGTGGC AGCTCTGGAGCAGGCAGCCTACAAGCTCGATGCTTATTCAAAAAAACTGGAAGCCAAGTACAAGAAGTTG GAGAAGCGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028607 |
Insert Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_028607.1, NP_082883.1 |
RefSeq Size | 910 bp |
RefSeq ORF | 432 bp |
Locus ID | 73689 |
UniProt ID | Q9CWG9 |
Gene Summary | Component of the BLOC-1 complex, a complex that is required for normal biogenesis of lysosome-related organelles (LRO), such as platelet dense granules and melanosomes (By similarity). In concert with the AP-3 complex, the BLOC-1 complex is required to target membrane protein cargos into vesicles assembled at cell bodies for delivery into neurites and nerve terminals (PubMed:16760431, PubMed:21998198). The BLOC-1 complex, in association with SNARE proteins, is also proposed to be involved in neurite extension (PubMed:19546860). As part of the BORC complex may play a role in lysosomes movement and localization at the cell periphery. Associated with the cytosolic face of lysosomes, the BORC complex may recruit ARL8B and couple lysosomes to microtubule plus-end-directed kinesin motor (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200298 | Bloc1s2a (Myc-DDK-tagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 2 (Bloc1s2) |
CNY 1,200.00 |
|
MR200298L3 | Lenti ORF clone of Bloc1s2a (Myc-DDK-tagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 2 (Bloc1s2) |
CNY 4,750.00 |
|
MR200298L4 | Lenti ORF clone of Bloc1s2a (mGFP-tagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 2 (Bloc1s2) |
CNY 4,750.00 |
其它Bloc1s2产品