United States
Germany
Japan
United Kingdom
China
Golph3 (BC031445) Mouse Untagged Clone
CAT＃: MC207095
Golph3 (untagged) - Mouse golgi phosphoprotein 3 (cDNA clone MGC:25472 IMAGE:4482612), (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4733401N08Rik; 5730410D03Rik; AW413496 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC031445
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCTCGCTGACCCAGCGGAGCTCGGGCCTGGTGCAGCGGCGCACCGAGGCCTCCCGGAACGCTGCCG ACAAGGAGCGGGCGGCGGGAGGCGGCGGCGGCAGCGGCGAGGACGAGGCGCAGAGCCGCCGCGACGAGCA GGACGACGACGACAAGGGCGACTCCAAGGAAACGCGGCTGACCCTGATGGAGGAGGTGCTCCTGCTGGGC CTCAAGGACCGAGAGGGTTACACATCATTTTGGAATGACTGTATATCATCTGGATTACGTGGCTGTATGT TAATTGAATTAGCTTTGAGAGGAAGGTTACAGTTAGAGGCTTGTGGAATGAGAAGAAAAAGTCTTTTAAC CAGAAAGGTGATCTGTAAATCGGATGCTCCAACAGGGGATGTTCTTCTTGATGAAGCTCTAAAGCATGTT AAGGAGACTCAGCCTCCAGAGACAGTCCAGAACTGGATTGAGTTACTTAGTGGAGAGAACAGATACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC031445 |
| Insert Size | 489 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC031445, AAH31445 |
| RefSeq Size | 2861 bp |
| RefSeq ORF | 488 bp |
| Locus ID | 66629 |
| Gene Summary | Phosphatidylinositol-4-phosphate-binding protein that links Golgi membranes to the cytoskeleton and may participate in the tensile force required for vesicle budding from the Golgi. Thereby, may play a role in Golgi membrane trafficking and could indirectly give its flattened shape to the Golgi apparatus. May also bind to the coatomer to regulate Golgi membrane trafficking. May play a role in anterograde transport from the Golgi to the plasma membrane and regulate secretion. Has also been involved in the control of the localization of Golgi enzymes through interaction with their cytoplasmic part. May play an indirect role in cell migration. Has also been involved in the modulation of mTOR signaling. May also be involved in the regulation of mitochondrial lipids biosynthesis (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201270 | Golph3 (tGFP-tagged) - Mouse golgi phosphoprotein 3 (cDNA clone MGC:25472 IMAGE:4482612) |
CNY 2,090.00 |
|
| MR201270 | Golph3 (Myc-DDK-tagged) - Mouse golgi phosphoprotein 3 (cDNA clone MGC:25472 IMAGE:4482612) |
CNY 1,900.00 |
|
| MR201270L3 | Lenti ORF clone of Golph3 (Myc-DDK-tagged) - Mouse golgi phosphoprotein 3 (cDNA clone MGC:25472 IMAGE:4482612) |
CNY 3,800.00 |
|
| MR201270L4 | Lenti ORF clone of Golph3 (mGFP-tagged) - Mouse golgi phosphoprotein 3 (cDNA clone MGC:25472 IMAGE:4482612) |
CNY 3,800.00 |
