Eif5a (NM_001166596) Mouse Untagged Clone

CAT#: MC207032

Eif5a (untagged) - Mouse eukaryotic translation initiation factor 5A (Eif5a), transcript variant 9, (10ug)



  "NM_001166596" in other vectors (4)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA410058; D19Wsu54; D19Wsu54e; eIF-4D; eIF-5A; eIF-5A-1; eIF-5A1; Eif4d; Eif5a1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207032 representing NM_001166596
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGATGATTTGGACTTCGAGACAGGAGATGCAGGGGCCTCAGCCACCTTCCCAATGCAGTGCTCAG
CATTACGTAAGAATGGTTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAA
GACTGGCAAGCATGGCCATGCCAAGGTCCATCTGGTTGGCATTGACATTTTTACTGGGAAGAAATATGAA
GATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAACGGAATGACTTCCAGCTGATTGGCA
TCCAGGATGGGTACCTATCCCTGCTCCAGGACAGTGGGGAGGTACGAGAGGACCTTCGTCTGCCTGAAGG
AGACCTTGGCAAGGAGATTGAGCAGAAGTATGACTGTGGAGAAGAGATCCTGATCACAGTGCTGTCTGCC
ATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001166596
Insert Size 465 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166596.1, NP_001160068.1
RefSeq Size 1293 bp
RefSeq ORF 465 bp
Locus ID 276770
UniProt ID P63242
Gene Summary This gene encodes an elongation initiation factor, which participates in protein synthesis. The encoded protein also plays roles in mRNA metabolism, cell proliferation, and cell cycle control. This protein contains a modified lysine residue called hypusine, which appears to be necessary for its function. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2, 5, and 19. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (9) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...