1810020G14Rik (BC005675) Mouse Untagged Clone
CAT#: MC207026
1810020G14Rik (untagged) - Mouse RIKEN cDNA 1810020G14 gene (cDNA clone MGC:11762 IMAGE:3153356), (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810020G14Rik; 1810055I05Rik; BB388670 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC005675
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATTGCGCCCGCTGTGTTGCGAGCTCTGCGTAAGAACAAGACTCTACGCTATGGAGTTCCCATGTTGT TGCTGGTTGTTGGAGGTTCTTTTGGTCTTCGTGAATTTTCACAAATCCGGTACGATGCTGTGACAATTAA GATTGATCCTGAATTGGAGAAAAAATTGAAAGTGAATAAAATAACTTTAGAGTCAGAGTATGAGAGGCTG TTATGTTTATTGTGCAGACAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC005675 |
Insert Size | 234 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC005675, AAH05675 |
RefSeq Size | 639 bp |
RefSeq ORF | 233 bp |
Locus ID | 66272 |
Gene Summary | Required for the assembly of the mitochondrial respiratory chain complex IV (CIV), also known as cytochrome c oxidase. Promotes the insertion of copper into the active site of cytochrome c oxidase subunit II (MT-CO2/COX2). Interacts specifically with newly synthesized MT-CO2/COX and its copper center-forming metallochaperones SCO1, SCO2 and COA6. Probably facilitates MT-CO2/COX2 association with the MITRAC assembly intermediate containing MT-CO1/COX1, thereby participating in merging the MT-CO1/COX1 and MT-CO2/COX2 assembly lines.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200115 | 1810020G14Rik (tGFP-tagged) - Mouse RIKEN cDNA 1810020G14 gene (cDNA clone MGC:11762 IMAGE:3153356) |
CNY 2,850.00 |
|
MR200115 | 1810020G14Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810020G14 gene (cDNA clone MGC:11762 IMAGE:3153356) |
CNY 1,200.00 |
|
MR200115L3 | Lenti ORF clone of 1810020G14Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810020G14 gene (cDNA clone MGC:11762 IMAGE:3153356) |
CNY 4,750.00 |
|
MR200115L4 | Lenti ORF clone of 1810020G14Rik (mGFP-tagged) - Mouse RIKEN cDNA 1810020G14 gene (cDNA clone MGC:11762 IMAGE:3153356) |
CNY 4,750.00 |
其它1810020G14Rik产品