Rnf144b (NM_001170643) Mouse Untagged Clone

CAT#: MC206979

Rnf144b (untagged) - Mouse ring finger protein 144B (Rnf144b), transcript variant 2, (10ug)



  "NM_001170643" in other vectors (3)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms BC025007; E130105P19Rik; Ibrdc2; Pir2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206979 representing NM_001170643.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACTCCGTCGATGGGCTCCAGTGTCTGACCATGACTGCGGAAAACCCACCCTCTGGAGACCTGATT
CCCGCCCCGCTCGTCACTTGCAAGCTCTGCCTGTGTGAACAGTCTCTGGACAAGATGACCATGCTCCAA
GAGTGCCAGTGTATCTTTTGTACACCCTGCCTGAAACAGTATATGGTGCTGTCAATCCGAGAAGGCTGT
GGATCTCCTATCACTTGTCCTGACATGGTGTGCCTAAACCACGGGACCCTGCAGGAAACCGAGATTGCC
TGTTTGGTGCCTCTGGATGAGTTTCAGCTGTATCAGCGGCTCAAGTTTGAACGAGAGGTTCACATGGAC
CCCCTCCGGACATGGTGTCCTGTTGCAGACTGCCAGACCGTGTGCCATATTTCAGCCGGAGACCCAGGC
CAGCCAGTGTTGGTGGAGTGCCCTTCTTGCCACCTGAAATTCTGCTCATGTTGCAAGGATGCTTGGCAC
GAGGAGTCTTCCTGTAGAGACAGCCAGTCGGCGATGCCAGAGCATGGGGCTCTCTTTGGAACGGATGCG
GACGCCCCCATCAAGCAGTGCCCGGTTTGCCGCATTTACATTGAGCGCAACGAAGGCTGCGCCCAGATG
ATGTGCAAGAACTGCAAGCACACATTTTGCTGGTACTGTCTGCAGAACCTGGACAATGACATATTCCTC
AGGCACTATGACAAAGGGCCATGCAGGAATAAGCTCGGCCACTCGAGGGCATCGGTAATGTGGAACCGA
ACACAGGTAGTGGGGATCCTTGTGGGATTAGGTGTCATTGCCTTGGTGACCTCACCCTTGCTGCTCCTG
GCCTCTCCCTGTATAATCTGCTGTGTCTGCAAGTCCTGTCGCGGCAAGAAGAAAAAGCATGATCCATCC
ACAACCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001170643
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001170643.1
RefSeq Size 4540 bp
RefSeq ORF 906 bp
Locus ID 218215
UniProt ID Q8BKD6
MW 33.5 kDa
Gene Summary E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes UBE2L3 and UBE2L6 in the form of a thioester and then directly transfers the ubiquitin to targeted substrates such as LCMT2, thereby promoting their degradation. Induces apoptosis via a p53/TP53-dependent but caspase-independent mechanism. However, its overexpression also produces a decrease of the ubiquitin-dependent stability of BAX, a pro-apoptotic protein, ultimately leading to protection of cell death; But, it is not an anti-apoptotic protein per se (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...