Hsd17b12 (BC037620) Mouse Untagged Clone
CAT#: MC206880
Hsd17b12 (untagged) - Mouse hydroxysteroid (17-beta) dehydrogenase 12 (cDNA clone MGC:46848 IMAGE:5375831), (10ug)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | KIK-I, Kik1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206880 representing BC037620.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCATACGAGTATCCGGAATACTTTCTGGAAATTCCCGACTTGGACAACACCATCAAGAAACTGATA AATATTAATGTGCTTTCCGTTTGCAAGGTGACACGCTTGGTGCTGCCTGGCATGGTAGAAAGATCTAAA GGGGTGATTCTCAACATCTCCTCAGCCAGTGGCATGCTCCCAGTTCCATTGTTGACAATCTACTCTGCA ACCAAGGCCTTTGTAGATTTCTTCTCTCAGTGCCTCCATGAGGAGTATAAGAGCAAGGGCATCTTTGTG CAGAGTGTCATGCCATACCTTGTAGCTACAAAACTGGCAAAAATACAGAAGCCGACTTTGGATAAGCCC TCTGCAGAGACATTTGTGAAGTCTGCAATTAAAACAGTAGGTTTGCAGACCCGAACCACTGGATATGTG ATCCACTCTCTCATGGGCTCAATAAACTCAATCATGCCTCGTTGGATGTATTTTAAAATAATCATGGGT TTCAGCAAGTCTTTGCGGAATCGCTACCTGAAGAAAAGGAAGAAGAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | BC037620 |
Insert Size | 534 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC037620 |
RefSeq Size | 1808 bp |
RefSeq ORF | 533 bp |
Locus ID | 56348 |
MW | 20.1 kDa |
Gene Summary | Catalyzes the second of the four reactions of the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle. This enzyme has a 3-ketoacyl-CoA reductase activity, reducing 3-ketoacyl-CoA to 3-hydroxyacyl-CoA, within each cycle of fatty acid elongation. Thereby, it may participate in the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. May also catalyze the transformation of estrone (E1) into estradiol (E2) and play a role in estrogen formation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201559 | Hsd17b12 (tGFP-tagged) - Mouse hydroxysteroid (17-beta) dehydrogenase 12 (cDNA clone MGC:46848 IMAGE:5375831) |
CNY 4,370.00 |
|
MR201559 | Hsd17b12 (Myc-DDK-tagged) - Mouse hydroxysteroid (17-beta) dehydrogenase 12 (cDNA clone MGC:46848 IMAGE:5375831) |
CNY 3,600.00 |
|
MR201559L3 | Lenti ORF clone of Hsd17b12 (Myc-DDK-tagged) - Mouse hydroxysteroid (17-beta) dehydrogenase 12 (cDNA clone MGC:46848 IMAGE:5375831) |
CNY 5,890.00 |
|
MR201559L4 | Lenti ORF clone of Hsd17b12 (mGFP-tagged) - Mouse hydroxysteroid (17-beta) dehydrogenase 12 (cDNA clone MGC:46848 IMAGE:5375831) |
CNY 5,890.00 |
其它Hsd17b12产品